Description :
From Genome Similarity Track
Location :
contig_57:39030- 40527
Transcript NameFunction/comments
g10475.t1hypothetical protein

Sequence
1497 bases(100 bases per row)
GCTTCCGTTCATAGTTTGCGCTAGGATCGCGGCGGCTGGGGCATCTCCAACGTATCATTAAAAGATCCTTGCCCTCATTTGTTGTTCGCTGTCTGGGTAC
CGCTAATGTCTCCATCGGGGTCATGCACAGATCATATAGCCTTTTCGGCTCAGCAGATTCTATGGTCTCCTCTTGTTCCATCCCTTTGACCACTGCCCCA
AGGTAGGAGATTGGTTTGCTCTCGCTTTAGTGCTCTCCAGCTTCGTCAATTGTAGTCTCCGGATCCACGAAAGTGAATAATCACAGTCTATCATCCAGCT
CACCTTGCGTACTGTGCGCAATTGTGATGCACGTGTGCATCATCTGCTGTTGTCGCGTGAGCACGTGCTGCCTTGCGTTTGTTCCAATAACCCCGGAGTC
GGCGGTACTTCAGCTCCATCGTCTCTGGTATCGGGTCACTCCATTTCGTTTTCTCTGCTTCGGATGGCAGCCCAGAATCCTTCTCTTTCAGCTTCCCCCA
ATGCTCTTGGAATCGATGCTGTCTCGCCATGTCCGTCAGTCGTAGTACGGTGCCGTACATATTGCCTCGGCTGTGTTGCTGAGCAGGTAAATCCGCAATT
ATTTGAAAATCACCTGTCCGTCTCCCATATCTGCACTATTTGGCTTTGTTCCTGGGGTTCTCAGATTTCCTTCCTTGATTCCTTCTATCAGCCAGTGCCG
TCGTGGCGATAGCTTCCGTCCGCTCTACTTGTTCATCCTTGCGCGCTGCCGTGTTGTTCCGCTCTCCTTCCCATCTGCCGTTGGACGGCCTTTAGCCCTG
CTTACGATTCTCCCCTCGCTTGCCGCATTGGTTTTGCTCTCCATCATCAGTAGTCACCCTTGAAACCTCGCGTTCTGCTCGACCTCTTGTCCAGCCGGCC
CCTGGTCCTGCTCGCTGTGCTCAACGTACTCCCAGCCGTGATTTCCTTCGGCGATCTTTTCGGTATCTGTTTTTTTTGCCCCCCCCCCCCCCCCCCCAGT
AACCGGGCCGGTTGTTGCTGTATTCGCTGGACTTGGGCCCACGAAGTATCAGTATCAGTATCGTGAGCGGGAGCCGGCGGATTTGGATGATGGTCTACCT
TACGCACACGTGCCCTGAACAGACAGCTCCCGCCAAGAGAAACCATCGTTTCGGCACACACACAATAGAGGTTCCGCAGCCCAACCTCATTAACCTACGG
CCAGGTACACCGCGACCGTCGTATCCGATATGAGGGGGCGACCCCAGACACAATTCAACACGGGGTGATCCCATTTCAGCATTCGTCATCATGAGCGTCC
GTACACCGTAGACGAAGGGGGCTAACCAACGATCTGTTTCTCGGTAATACTCCGGCGGACGATCAGGTTATAAGTGCTCAATGACAGTCAAGGGCAGTCC
ATCAACACAGCCCACCAGTGTGCAGGCACTTGGTGAGAGTGAGCAACAATCTGTCAGCCTAGCGCTCTGGTGTGCACGTACTTGGTGACGACAGTTC