Description :
From Genome Similarity Track
Location :
Scaffold_25:39023- 40521
Transcript NameFunction/comments
Phypl_g1044hypothetical protein PHYSODRAFT_354319

Sequence
1498 bases(100 bases per row)
GCCACACTTAActcgtctgctgcacgtgctccTCAAACACGGGGCGAGCCGCCTTGATGTTAAGGTGGATCGTTGCCGGTTCTACTCGACCAAATTATAA
ATGAATAATGAGAAAGTGTCAGTGACCACGCAATTGAGAAACACGCAGGCCAAGGAAGCCCAACCAATAGCTGCAGCTACTTACGGATCGAGTCGTCGGA
CATGATGATCATGATGTACGTGTTGGCGGTGAAGAAGTCGATGAAGGCCGTAAAGTTCGAGTTGCGCACCTCCATGCCCTGGAACTGCGCCTGggtcttg
ctgcagctcagctTGAACTGCTTGATGATGTTGCTGATCTTCTCGAAACGATGGATGTCGCGGTGATTTGTGTGCGTGGCGTGTGAGATCACAAGGAAAG
TTGCACGCTCAAagagcaccacctcgtcaGCGCTGCAGATAGAGCAGAAGCTGTTCAGGTGCTTCTCCAGGTCCTGCATGTTCGGGATCAGCGAGTACAC
AATGGACGACCATGCGCGGTACAGCGTTTCGTCCCAAATGGACGTGCCAAAGCACACCGTCGGCAGTTGACCCGTGCGTGCTAGAATCATCTCCTTCTTT
TGGTTGAAAACCTGCCCACAGAAAGCACCCGTGTTTAGTCATATTTCCTTTAGATAGGACGAAGGCCTCGTAGCCCATGGTCACGCACGCGCTCTCGCTG
GTCCTCCGGCACGAGATCCATCTTGTGGATCAGCACGAACACCTTCGCGTTGCTCGAGTTCTGGTCGATAGCCTCCAGACAGCCGTCGAAGTGGGCCATA
TCTTTCTGTAAGGAGCCAACAGTCCATTTCAAAGTCAGCACCACCCTCTTACACCGCTACTCCCCACAAATCAACCGTACGTCGATCTCGCGGCTCTCAA
TGTCGAACACGTAgatcagcagctccacacTGCGGAAAATGTGGTCACGCTGGCTCTCGAAGTAGTTCTCGTAGAAGGCATCCTGCCTGCAATGAACACC
ACAGCACTGGTGTCAGATTCAGCTTCTGAGTGTATCAATCAACTTCCCGTCGCCGTACCCGCCGCAATCCCACAGATTCAGCACCAAGTTGCCCAGGAAA
CGCACGTGCGAGTGCTCCACGTCCACTAGAAAGTAGCAACAGCCAGAATCCCGTCATTCTCCTCGTGCCCCTCGACAAAACCAACTACATGCTGCGTATC
GGTCGCGTACGCGTGGGTCCCAGTCGCATCGTATCACGAGCTGGTCACACGGCATGCAATAGAAGTCAGAGCGTTAGGCATTGCGGTTGGTATCACAGAC
AGCATCGCGTCCAGTACCCAGATAGTTGGCGAAGATGATGGAGCGCATGGACGTCTTGCCTGAGCCGGACTTGCCCATCAACAGAACCTACAGGCGGCAG
GCGCATGTCGGTCAGTAGACACCCCGCGGCAGCGACGTAAGGGGCTgtgagggggggggcagcCCCGAGAGacgcaccttcttcttcatggcggaGAC