Description :
From Genome Similarity Track
Location :
Scaffold_1786:3902- 5374
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1786-snap-gene-0.2ATP-binding Cassette (ABC) Superfamily
Pytiw_DAOMBR242034maker-piw_contig_1786-snap-gene-0.32OG-Fe(II) oxygenase superfamily protein

Sequence
1472 bases(100 bases per row)
CACGTCACGGTATGATAGGATCCCAAGCTCCTCCGACCCACGGTATTCACTGCCATCACCACAATAGCCAAACAACACAGCTGGTCAGTCTATAATTCAA
GCAGCCCATACACAATGCTCACACATATCAATAGAGAAACACAAGACCTACCGATCAAGAAAGTGCAGAAACTCCCGGGTCTCCTGTCGATCCAGGAACG
CCAGGCTCTGATTCGACTTCTCGAGCAGGAGCGGCAGCACCGTCATGAACAGCGCGTTCGACAGCGGCGGCACTCTCGCGGATATGTGCGCTTCAGCGTT
CAAGCGCGTCTCAACAGCCTGCGTGCTCGGCGTCACGAGCGCCAGCCATCGTTCCTTCCGCTCGAGTTCAATCTGCGTCTGTTCGTTCTTCACCGCCGAT
GCCAGCAGCATTACGCGTGACCCGCCGTCGTCACGCATCGCATCTGCAGCGCTCATATCCGCATAGTCGCCGCCCGGCGCGCCAAAGACGAGGCCAATCG
AGGCATTGTACTCGCAGAGCTTCATGATGAACACGAGCAGCAGCGCGAGCGGCACGATAATGTCGGTCAGGAGCGCGGGGAAGAGCCACTGGCCGCGCGC
CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCG
GCTCTCACGCTGCTTCACGCGCCAGTTCTTCCACAGCAGCACGCGCACGGACGCGCCGACGCCCGCCATTTTCTTCTCTTCTTCTCGTCTCGTGAGCGCG
GAATCGATTCTGAGCCTTTTTGTACTGGGCGATTTCGTGGGTGGGGAAACCAACATTCCGAAAAATGGAAAGTGGCATACAAATCGCAAATTATTTGTCG
AATACTAGGATAGTTTGGAGATGGAAATTGGGTGCGCAGTTGAAGCGATGAGATGCGTTATGAGGCTTCTAAAGTGTTTGTGTGTGTGGCTACTATACGT
CCTGCGGGAGCTTGTAGTGGGCGATCTGGATCTCCTCGCCCACGTTCGCGTAGTCGCCCGCGAAGCGCTGCGAGCGGAAGTGGCGCCAGCTCAGCGGTCT
GTACGCGGGCTTCTCGCGCGCGTCCACGACCACGGGCGCGACGCTCGCGTCGTAGGACGGATTGTAGAAAAACGGCGCCGAGAAGCGCTCCTGGTAGTCG
TTGGCGAGCACGCGGTGCAGCGGCGCGACAAATTTGTCGTTGGACCAGATCTGTACCATGTCGCCAATGTTGATCACGAACGTGTCCTTGATGGGCGGGA
TGCGGTGCCACTGCTGGCTGTCGCGGTGGAAGACCTGGAGCGACGAGACCTCGTCGTCTTGGAGCAGCACCG