Description :
From Genome Similarity Track
Location :
Scaffold_13:390187- 396783
Transcript NameFunction/comments
Physo_108516predicted protein
Physo_159057PsAvh84
Physo_130891hypothetical protein

Sequence
6596 bases(100 bases per row)
GCATCAACATGGCCTGGGGCATCGGCGTGCTCATGGGCGTCTACTGCTCTGAGGGCGTCAGCGGCGCGCACTTGAACTGCGCCGTCACCTTTGCCCACGC
CGTGTACGGCCGCCTGCCATGGTGGAAGGTGCCGGGCTACGTGGTCTCGCAAGTTGTTGGCGCCTTCCTGGGCGCGCTCGCCATCTACCTGCTGGACTAC
CAGAAGCTCAACAAGGTGGACCCGGACCAGGAGACGACGCAGAGCAACTTCGCCACGTACCCGAGCGCCGACATCAGCAACATTACGGCGTTCTACACGG
AGGCGCTGGCTACGGCTATGCTGCTGCTGTGCATCTACGCCATCACGGACCAGAACAACCGCTCTCCCGGGACTGTGGGTACGCCGTTTGCCTTTGCTCT
GATGATCATGGCGCTCGGTATGAGCTTCGGCATGAACACGGGCTACGCGATGAACCCTGCGCGAGACTTTGGGCCTCGCCTGCTGACGTACGTGGTGGGC
TACGGCTCGAAGGTCTGGACTGCGGATAGTTACTACTTCTGGATCCCGATCTGCGGGCCGTTGCTTGGGGGTGTTATTGGCGCGGGACTGTACACTTTCC
TGGTGCAGATGCAACACCCGCATGAACACGCGGCTTAATAAATAGATGGCCAAGTGTTCGTGAATTACAGTAAGAATTAATCGAGGCGGCGTGGCATTGA
TGGTAAAAAAGTGTGGGGGCCGGCGCTGAATTGGTCGATCAGCACTGAACGGAAACAAGCCATAAGAAAATGTAATCGCAGAGCATCCACGATGATCCCT
CGCTGCCGGCGAGTGATCCGGTAAGGCTGCCGGTAGCGTTCTTGCTGCGTAGCGCACGATCCAAGGGAAAAGCAGCATCGACGCCGGAACCCGCGGCAGC
AAGAGTCGCTAAAATCGCGCAGGTGAGCAGCAACTTGGTCATTCTTCTTGCTGGAGTGAGTTGAAGGAAGCCTAATCGATATTCATTTTGAAGAAGTTTA
ATTAGTAAGTGCAAGATCGACTTCGGTGAGGCATGTTTTCTGACTTTAACTAACCTTTCGGTGCCGCTGAAACGTTGGAAACTCCACCAAACTATGTTCG
AATGGATTGCTGCGTGCATCACTAGCAAAGCTCGGTATGGCTGTGTCCATCTTCGTCGCTCTTGGGAGGAGCAGGCTCCTGGTCATTCCGGAATAGGCTC
CCCAGCACTTTGAAGTGGGGATATGCGTGGCAAATATCCAAGTAACAAGGTAAATCGACCGTTTCCACAATGTGTTAGACACTTGATATCATCAAACATA
GGAGTAATCAATGGAGTTGGAGCGCACACACCTGTGGTTTTCGGATGCCACCGTCTAATCTAGATGGCATTCCGTGCATTCGATGGGGCATTGGATAACC
ATTGCGAAACAAATTGTAACCTCGAAGAATGAAGTGTGGCCCGCAGAAGTCTTCGGTTGAATTCCTTTACCCCCCACCCCATCAACCACCTGATCCTAGC
GCCAATTTGAGCGACAAATTAGGAAACAAATTCGTCGCTGGTCAGTACTAAGAGCGGCAAGTCATGGAGATATCGATGCACATATACATATGCAGTTTTA
GAGAACACCACTTGCAGCATACTACCCGCCAATACAACATGCACCAAGCTCAATGTGTACTCAAATCAATAGTTCGTTTTTTTCAGGGCCGCAATGCTGG
GAATTAAAACAAATGTCATGGAGCATTAACAAAATATTGAGCGAACCACACAGGAAAACTGCTCGAATTCGGAACGTCTTGGCGGTACTGTTGCATGTTC
CTTCATATACGTCGGATCAGAACTGTATATTGTAATTTAAATACTAATTACTTCGAAGTGCAACATATTAAATGTGTTTTCCTAGAGTGGATCCTTTAGG
AGCAAAACGAGCGTGCAGATTGACAGAGAATGTAGTTTTGGGCCCTCTGTGGTGTCCGGGGATGTGAACGTCGAACGACTTGGGTTCGAAGTGGCGTGTC
AACACGATATTTAATGCTTAACCGTGAAGTGGAAAAAAATCAATCGAGCAGGGTGTATGAACCAAATGAGCTCAGATTGAAGCTGGAAATCCTGTCGTTC
AGCTGGCCGTCGGCGAACTCTTTTAACTTCTGTCCAATGACTTGGCTTACATTATTTCAAGAGCAAGAGCTGAAGACTTCAACGAAGCACTGCTCGAACA
CAAAGACGGAGTGAACACGAGACCGTTTCAAAACAAAAAATGCCACGTTGTATCCCTATAGTGCAAAACAAAAGAAAGAAGGTGTCGTCTCATCCTATGG
GAAACTTTGACTTTCGCTAACGCAGCTTGCCCAACCTAGACGATGTGTCACTCAAGAAGTTCCATGACTTCACCGCGCTGTATTTTTAGTCTATGCTCTT
CTTCATACCGTAAAGGCCGCGAAAATTTGCACACTCGTACTTGTACACCAGATCTCCTCCAGATGTCCGAGTAGATGCAAACTCTACTATTAAAGTGTAT
TAGCAGAGACAGTGGATGGTCTGCCAATTATTCCATGTGTAAGTGTCCTCAAGTCAGCTTTACATCTCAATTCTCATCTATCGTTGAGACCAGCATGCAA
AGTCCTGCGATGGCCTTCGCAGGAGAACCCAGCACATCATTCCTCTCGAATTCACTATCACCGTAGCCCCACCGCAGTCTTCAGTTCGAAATTCGCCTTC
AAGCCCACAAAACGCCCAATCCAGTCCAGTACTTCTTCGAAGTACCTCAAGCTCAAGTCCGAAGATGCGTACCTCTTTCGTCCTGTTGGCCGTTACGGCT
ACCGTAGTCACTTCTGACAATGTCCTGTCGATCAAGTCTGGCGCCGAGCAGCGGTTTCTGCGGTCTCACAGGGCCCACAGAACCCACCACGCTAACGATG
CTGAAGAAGAACGTGGACGGGGGCTCAACAGTCTACCGGATCAGTTCAAGAGAATGAAGAGTCAACCTGAGTTCCGTGAGACCATTTTCACCTCGCGGAA
GAGCGGCATGGGGACCGTTGACGAAGCCGTCAAATTCATGAAGTCCCAGTATCTCGACGACGACCATATCGAGCATTTCAAAGAGGCATACAAAGCGTTT
CTGAGGAACAACTAGCAAGCAGAAATGAATCACCCATTTTAGGCTTAGATAAACCACGACGAGTATTTTTTTCTCCTAAAGAGGTTTCTTCATCATGAAT
TTACGCTCTTAAATCCCTTCTGATGTTCGTGTCTTTTTTTGTGTAGCACAGTAAGCAAATGGGTTTTCAGCGGACGTCGACAGACTCATCGAACGAGTAC
TCAAGCACGAGGACCAAGCAGCCGTGACTCATGGCGGACGACGACTACCTGCTGACGAACGAAGCGTGCATAGTCAAGTACTCGATGAAGGACAAGCGCT
CAGTGGTCGACAAGAACCCGATGATGGACGAGCTCTTGCTGACGGACAATTTGCTGGCGGACGAGTACTCGTTGGCGGACAACTACGCGCTGGTGAACAA
CTACCCGATGGTGGCCAACTACCCGCTGACGGACAGCTACTCGCTGATGGACGAGTACTAGTTGGTGGACAAGAACTCAGCGGTGGACAAACACTCGTCG
GTGGACAAGGTGAACATGTACTTGGTGGCGGCGGACCAGTACACGGTGAGGAACTACGAGGACGGCAACTTCAGCTACGCGTACACCAACTACACACAAC
TGGATCCAGCGGATCTGGATCCAGGCGACTGCTCACTGAGCAGTGCTCAGTCTTGAATTTGCTCGGTGTCGGATTTGCGCTCTCGGACGAAGACCAGAAG
CAGACCAAGGACGCCGTGACGATGCAGCAGAAGCAGCCAGTGTCCAAGTAGAACATGCGATCACTAATATAAGTTGGGGCTGCGCGAGTGGCTCCGGCGC
AGGGACGTCAGTTGAGTCCCTGTTGCCAGTGGTTGTTGACCTCTTTGTGCGTATGTATAGGGGACGACGCCTGTTGCTATACGACCATGGGCGAGACCCG
AAGCAAGTACTGCGCACGAAACAAGCGCCGCTTTCTGCACTGATCGAAGGCCCAGGTTTGCTGACTTCTTCGAACTTTTGTTACCTGATTTCTCTTACAC
TTTTGCATATTCGTACCGTCCGATAGCAAACTACATGTACAACAGCACATACTCTCATATATCTTTATTACCCCCAGGGGGGAGGGGTCGCAGTGAAGAT
AGATGTACCATTAGTAGAATTTAAACTAATAGGTAAACGCGGACAAAATTGGCAATGCTTGAGTACATCGCCGGAAGGCTCGTAGCCAAGTAAATCAGGC
GGCAAACTCACAGTACGCACATTCTTCGTTACCGTAAAATTGTACGCAATTAACCTTTCCTTGCTTGCTTTCTCAGCAGCAGCAGCATCTCCAGGGTGAA
GTGTCGTGTAGATGCTGGAAGTCTGTAGCTTTTGCGTCTTTGTCTGTGCTGAAAGTTTATAGCGCTGAACCCGCAGGGAAACGGTTTCCACAGCTTTTCA
CCAAAATTACCAGGTTCGAGACTGTTTGGTGGCGAGATTTGGACCGGTCGCAACCTTGATGGTTGGTCAAACTAAGCGTTTTGAAATCCTGTACGTGCGG
CTCTTGTCGCGTTCGAGCGTTGTTGTAACCAGGAGTAAGAAAACAAAAACAAATGCGGTCCAAGACACGAAGCCTAGCGGCAATAAATCGGTTTGAGCAC
CTGTTAATTTCAAGAGGAATCTTTTGGATTAGAGCTACAACGTCTCCCGCGAGAACATGTCATCCCCACACATCGTTGATGTGTTTACTTTAGGTAATAA
TTAAACAAAATACTGAAGTAGCAAGCTTCACCTTCCACCTTGAATTTAACCTCAAATATCTTTGCTGAAGTCTTTGTTGAATGCTCGTTTAGACAGTTCC
TAGACAATTGACATGACCGCAAGATGTCCAATTAATCCTTCTCAATTTCGGCTTTTAGACTTAACCAAAAGTCTATTAATTTTCTGCATTAGCCGACTTA
AGAAAACTTATATTATTGTGAGAACCGGTTAAAACGCCCATCTATAGCAACCCCTTATTAGATCTCAAAAGCCAAATTAATCAGAGTACAAATCAGGTTT
GAAATCGATCGTGACCAATATGCATCGCTTGCCTTCGCGATTGCCCAGTAAAAGGTGGGCATTCTGCTGCAAACGCGGCTATATCGACTAGATCTCCATA
AAACGATCGCCTAATCTGCACATCCACTCACACATGTATCGCAGGGAGTCGATCGGTTTGAAAATCGATCGATCTAAATCAGGGTGTTAATCAATCGATT
AACGAGCAAAATATGCAAATGAAGCGGGTTTCACAATAATATTTGTCAGGCGTAGATTTCACCTCAGTAAACGAAGGGTCACTCTCGGAACTGCGAATTT
GTTAGCGGGGATGGGTGTCATGCGCGTTAAATCCAACAATGCCCGACGTATCGACTGCACCACTACACGCAGGACTTATCTATGAAAAACCCTGGGGACA
TCTTCACAGTCTCAGACGAAGTGAAGCCGCTCGAATCCACGCACCATTCACACAGCTGATGATTTAGAGCCTTAGTTTTAGTTTTACGAGAATGGCCGTT
TCACCCGCTCCCCATGCAAAAAACCAAGTGAGCCACTGACGATGAGTGTCACTGTTGACTGGGAGTACTGCATACACGCATTGGAATATTACACACGTAT
AAAACAAACTGTCAAATGGCCGCGCCTAGGTAGTAGCATGGCAGCACGGGGGAAGCGGGAAGCCACAAGGCCCGACGTAGCATTGAAAAATATTGCAATA
GGTGCAGATTAAAAGGCGATCATACCATACAAACTTTCACAAGAACACGATTTAGCTCCAAGTAGGATACTGTATCGGACGCACAGAGAGCTGTCGAAAT
TGCCATGGCATCTGTAAACAAGACACAACTTCGTACGTCCATATAATTTCTGTAGCAATCGCCAACACGAACTCGACAGATCTCAAGAACCGAAGAAAGG
TTGTGTGTCTCTGCAGCGTAGTTATCGAATGTCCTACTTTTTGTATTTGTAAAAATACAGTCTAGAAAAGTTATTGAAAAGCGATTTATAAAAAAACTCT
GAGCAATTTGTTGACATTGCATGTGAGCGTCCGGCCTTTCAGATTGCCCCGGTTTCTTCATACTACTTCCGCACCCAAGTAAATGCATACTAAACAAAAC
CTGAAAGATACCACCTCACGGATATCGTTGATTTCACAAAACGCCTTTTGCATAATCCGTGTACTTACGTACAGGTAGGTACTCCAAAACGTCACAGCTA
CAACTTACAACCATTCAAATCAGTAGCTGGGTACATGTGCGGTTGTAATGCCGCAACGCGCTCTTCTATACATGTATGATGAGTTTCGGATCTCTATAAC
GTTTTCTGAGTTGACTCGGACTCGGTCAGTACCAGAGCAGATGATACTCAACAAATCCCTCACGTAGATGCATCAGTTACCACTGGTAACTTACCAGTAC
ACCTTTACACACCACTGACAGAAAGTGCTCTAAGAAAATTGCTCGATCCGATGCTTTGCCTCACATCTCGGAATGCATCCTAATGCGCAACCCAGC