Description :
From Genome Similarity Track
Location :
Scaffold_20:390180- 396549
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007920Similar to Pcyt1b: Choline-phosphate cytidylyltransferase B (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G007919Similar to Rgp1: Retrograde Golgi transport protein RGP1 homolog (Mus musculus)
Pytul_DAOMBR144PYU1_G007918Similar to Pcyt1b: Choline-phosphate cytidylyltransferase B (Rattus norvegicus)
Pytul_DAOMBR144PYU1_G007917Similar to B9d1: B9 domain-containing protein 1 (Mus musculus)

Sequence
6369 bases(100 bases per row)
GGTGGTTGCTATGCTAATAATGTGGACGTCCGCTTTATAGCGATTGACGGCCGATTTGCTCCGTCGCCGCAGAAGTCTCAGGGTGCGACATCGACAGGCG
GCGACGAATTGTCTGGCGCTGCTCGCGAAGCGATGTGCGCTATAGTGCAAGATACAATGCGATAATTAGCCAGCAGATCAAATGCATCCAATCAAAAAAA
AAATGCAAGCAAGTAGTACGCACCAGCGAGCCTTCGCGCCGAAAGAGGTCGAGGAAACCATGCTGCATGTCTTCGGCCTTGCCGACCCACTTGTGCACAA
AGCCGTCGACGTCGTGCTTGACCTTGTCAACCGCCATGTCAAACTTGATGCTCTGCTCCTTCATGAACGGCACGTTCATCTCCTTGCCCGTGTACCCGCG
CGCCAGGTTGCGGCGGATGAACGTGTCGTACTCGGCGACGATGCGGATGATCAGGTCCGACGTCGAGATGCCGTCCGTGCGCTTCGTCTCCAGAAATTTG
CCCATCGCCTTGATGCGCGCATACACGTCGCCCTCGGACGCCTCGCCCGACGCGTCCGAGTACGGCAGCGCGTCGTGGCACACGTAGTCGATGTTGTGCT
TCTCGATGAACTCGTCCGTGATCACCCACGGCGCGTCCTCCACCACCTCATCAACCCACTTGCAGTGGCGCAGCGACTCGTACCGCTCCTTGTCCGTCAT
CACCGTGCGACCCTTGAGCTTGTGCGTGATCTCGTCGCCGCAGCAGCCCACCAGCAGGTACGTGTTCGGGTACGCCTCCTTGCACTGCTGCAGCGCCTTG
GCGTGCCCAAAGTGGAAGAGGTCAAAGATGCCGTCGGCGTAGAGTCGCAGCGGACGGCCCGTGAGCGTGCCCGGCTCACCCTCCACCAGCGTCTTGCGGT
ACGGTTGGTGCTCGCTAGCAATATCTTCGTCCGTGGCCACCGAGTTCTGTTCTTCTTGGTGCACATTAGTAGTGTCCTTGGTATTGCTCGCGTCGACAAC
AGCGGTATCAACCTTGGGCTCTTGATCAGGCTCAACAGTGGGCACGACAGCAACAGCAGCAGCTTCCTATTCGGCATCAACAACACCAACACACCGCAGC
TCATCCATTAGCCATCTGCCTAATCTCCCCATGTGCATGAGCGTACAAAGACTCACCGTGGACGTCATGGCGGCGGGGCTTCTTGATCAGCGCGCGGGAT
TATTCGAAATGGAATGAATCTATGCGCATTACCTCATCAGCGTGCGGCAGAGAGGAACGCTGCATTTGTCTTGAGAGATGGACCACGGTCCTATGGTCTG
ATACCGCAAATTATCTATTCCCACTTCCCTCCATTCCCATCGCGCCCTTTGGCGGAGGAAGAGGCGAGGAAGAGAGCAGCTGGCGGTGCCTCCACATGGA
TACGCTCTTCCTTCAGACATCTCTCTCTATGGTCAAGCCACCACGACCGCATCACTACGAAAGTTGGCGCATTAAGTGCGCCTTACGTCATTCTTAAATG
CATATCGCGTACTTAGTGGTAAGAACAGAGGGTTCGTACTTTAGTGAAGTGACCACGCGGAGAGCGCATGTGACGTTGAGGAACCGAGTATTGAGCCAAG
AGGAAGAAGAGATGACCGGCACGGAGAAAGCGACTGCGGCCGCGGGGGCGGACGCGACGGGGAACCAGCTGTCGGCGGAGCTCTCGAGCCGATACTTTCG
TCCCGGTGGCGTCGTGCGCGGCGTCGTGAACCTGCACACAGACCGCGAAAAAGCCGACGCGTCGACGGAGATCGCGTACGTCGTCGCGCAGATCCACGCG
CACGTGACGGTTGACAGCAACCTGCTGACGGTGCCAGTCGTGCCGCTGCTGTCGCCACGCTCGGCATCGCAGATTGAGCGTGAACGTGCAGGGAGCGGTG
CGGGCGCTGCTGTCCCTCAGGATGCGTTTTTCTTTGAGAAGATGAGCGGCGCGTTGCCCGATGTGCGCACCTTCTCGGGAGACACGGGCACCTGCATCTA
CCAGTCGGTACCAACGACGTTGCTCTCGGATATCAACATTGCGCCGACACAGCAGGAGCTGGAAGCGACATCTTCACCATCGGATGCAGGTGCTGTTAAA
GGGAAGGATGAGACGGCGAAGCGTTGTCGACGAGAGTTTGCGCTCGCATTACCAGAAGTCGCGTGTCCGACGTTCCGTGGCACCGCTGCGCGCGTGTTCT
ACGTGCTGTCGATCACGGCGCAAGGCGCGAAAGAAGGAAGCACGCCATTCTCAGTGCATCTCCCGTTTGAAGTGTATGCGTCCGAGTATTTCTTCCAGCC
GACGACGCTCGAAAGCGCCGATGAGTATGCCGCAATGCATGGCAACGATGGGAAAGGAGCGTCACCCTCGTCATCAGTCAGAGGAGATCGAAGCCTAAAG
CGGTCCAACTTGCGCAAAGAACGCAGCATCTCGGTGGGCGTCATCCCCGTTGGGGTACGCAAGGGAAACGAGATCCCGTTCGAGCTTCGGCCGTCGCTCA
TGCACGGCCGCGTCGAGACCGAGGCGATGCAGCGCGCGCAGACGAGCATCTTTACGATCGGGAAGGACAGCAGCCACTTGGTACGCTTTTTGCTCACAAA
GCAGTTCTTCCAGCCAGGTGAGATCCTGCTCGGCGTGTTTGACTTTTCACGCGCCGTGATCCCGTGCTACGAGGTCGCGGCGACGCTGTGTCTCGAGGAA
ACGCTCTCGTCCATGTCGCTGGACCCGTCGCGCGTTGTGCACTCGAGAGAATTTGGTTCGTTCCACGAATATACGGGCTCGGTGCTGCACACAAACGTGC
GCTTCTGCATCCCACAGGACGCGCTGCCGAGCATCCGCACCGACCTCGTGTGCTTCCAGTGGGTCATTCGCTTCGAGTTCACGGCGGGCGTCGTGCCGGA
CCCAGCGGCTTCGGGAGATGATGTCACAGCGAACAACAATAACGTAGCACAGCGGCAAACGTTTCGATGGCAGGTGCCGATTGTCGTACGGCCCGCGAGC
GCCACGGAGCGCAGTCAGTACGCGAACGTGCCGCACAAGTTGTTTTCCGGAAGCCGCCGGACGATCAACTTGGAGTAACGTCGTTCAGATTACAGCCAGC
CAGTGTATCTGCTTCCATAAGTATAAACATCCTTGAAGCATTGGTAAAGAAGCCTATTGGCCCATGTCCCATGGAGGAGGAGGTCAGCGTCACTCGCCAC
TAGCCATCCCACATTTTTAAATTTGTCATCATCCATTAAAGTATCCGATACACTGAAACCCTTCGTAAACGACAGCAACGCACCAGCTTCTCTTGTCTAA
TGCATAATAATATGCAGGTTGTATGACTTGGTACATTGGATTTAGTTAGTATATATGTGAGCTTTACATAGAAACGTTTGTCGATCGGATTTCAAATCCC
GGTAAATCAGTACATTGCAATGGATTCAGTGGAATAGACCAAGTAAATATGCGCTTTCAGAAGCCTCGTACAAGAGAGGGCTCACCTGCCAAAGAAAAAG
CGAGCGTTACGCTTACGCGCGTTAAGTGCGACACACGTGGCGTGACGCACTTAGCGGATTTTTGTCTGTTTGTTTGTTTGTGACTGACTATGCGCTTTGG
GGGGAAAACTGGGGCTGTTGCGCTGGTTGCCAAATAGAAAAACCGCGCCAACCGCAGAAAAGCGCAGAGCGACGACGACGACCATGGGCCGAAAGGTACG
AGAGCGATCCACGCAATTGCATGGAATAGTGAGGGAGGGAATAGGCGCTAGTGGTTATATATATATATATATATATATGCACACAGTAGCGGTGGCGACT
TGCGCGCTTCCGTGGAATGGCGCTTTGGGGGCGGTGACGTGGCTCACGCAGACGCGCTGACGCATATGCTGTTGTGTGTGTTTGTGTATGGGCTGAACGG
CGCACATGTAGAGATCCGCGAGCGAGTTTGAGAAGGAGCACGATGACGAGCACCAGCAGCCGCAGTACGCGACGACCGTGGACGTCGTAGCGGAGGACGA
CAAGAGCGACTCGGACGAGAGCCCGGCGAACGGGAAGACGGCGGCGGCGCAGGATCACTCGAACGGCGGCAGCAGCGCAGAGGGTGACAATGACGTAGAG
GAGAAGGCGCGCAAGGCTTACGACGAGTACGAGCCGTACCGCAAGACGCTGGTGGAGGGTGAGCCGGGCACGCTCACGGGCCGTCCGCTGCGACTCTACG
CCGACGGCATCTTTGACCTCTTCCACTTTGGGCACGCCAAGGCGCTGCAGCAGTGCAAGGAGGCGTACCCGAACACGTACCTGCTGGTGGGCTGCTGCGG
CGACGAGATCACGCACAAGCTCAAGGGTCGCACGGTGATGACGGACAAGGAGCGGTACGAGTCGCTGCGCCACTGCAAGTGGGTTGATGAGGTGGTGGAG
GACGCGCCGTGGGTGATCACGGACGAGTTCATCGAGAAGCACAACATCGACTACGTGTGCCACGACGCGCTGCCGTACTCGGACGCGTCGGGCGAGGCGT
CCGAGGGCGACGTGTATGCGCGCATCAAGGCGATGGGCAAATTTCTGGAGACGAAGCGCACGGACGGCATCTCGACGTCGGACCTGATCATCCGCATCGT
CGCCGAGTACGACACGTTCATCCGCCGCAACCTGGCGCGCGGGTACACGGGCAAGGAGATGAACGTGCCGTTCATGAAGGAGCAGAGCATCAAGTTTGAC
ATGGCGGTTGACAAGGTCAAGCACGACGTCGACGGCTTTGTGCACAAGTGGGTCGGCAAGGCCGAAGACATGCAGCATGGTTTCCTCGACCTCTTCAGCA
AGGACGGACGTCTGGTAAGTCTATCGTTTGTATCATTATGCAGCCCATGTGTATCATCTGGTGGTCTATAATGCTAACTGTGCTTGTGTGTATGGCAATT
GTCGTAACAGCGCACGTCGTTCCGAAAGCGCCGAAAAATTATTAAGGAGCGCCTCTCGGAGCGTCTCTCGGACATGGCGCGCGAAGGGCTCTGCTAAAGC
TTCTGCCACATGCAAAAAAAGCGGACTCGTAGTGTAGGAAAAGCAAATGTCTGAGAGAGAGAGAGAGAGAGAGAGAAGAAAAGGACGCGGTTGGACAGTC
TGGTTTCTTTCTCGAGATACGTTGATGATGCGACCCGAAACACACATATATTTTGTGCATGTATTGAGGAACACTGCGTTGCGTCTAATGCCAAGGAAAT
CTTCGCTCATCCTGATGCGTAGCCATACTTTTTCATGCCAGATGTGACGACGTTGAGCACGAGCCGCACTTTGCCTGTTGAGCACACGCGCGTGACCTCG
CGGCCGTCGTTTTGCGTAATGAACTTGGCGTCGAAGTACTACAGCAAGCGACACACATTAGCACCATTGTTCTCCATAGAAACAGCGCATGTACCACAGC
ATATTGACTCTACCTCTGGGGGTGATCCTGTGAGCCACGCCGTAAACTGCTGCAGCAGTGACGACGAGAGTGGCTTGAAGAGCGGCACGTCGCGCGTCGT
CGAGCCCGCGCACGTCGGTAGGTGGACTGAGCCGTAGCCGCGGATCACGTCGCGGCCGAGCGCGTCGAGACCGTAGACACTGAGCACGATGCGCGGCCAC
CCGAACGGGTTGGTGCTCTTGAATGAGATGTCGATCGGGAAGTTGAAGATGATGTCGTCCTGCTGGTTCGACGCGTACGCCATCTGAGAGAGACCGGTGT
CTGCGCCCTGTAAGATACGCATAACCAAGGTGGCAAGGGTGTCATTCGCGGCATCCGTAAGACGCAAGTGATGCTACTGGATGTGACGCACGTGAAGGAC
GCGCCAATCTGTTCCATAAGTCATCGCATAGCGGCAATACAAGTTCGTCACGCCTGGATACTAAGAACAACGTCACATACACAATAGTAGCCACAAATAA
TAGCGCATTCAGCAGCATTAGATCATCGCCTATGCACACGCTCAGAGAACCAGCGTGTATTGCAAACATGGGCAGCGCACGCGTACATCGACTGCTTCAA
CTTGGCCGCTGTAGATGACGTGAAAGCCGGACGCGGGCTGTGCTGTCGGCGGCATCCCACCAACGAGTCTCTTTTCTCCACCTTCTTTCCCATCGGTCAA
CGCAGCAGTAGCAGCAGCGGAAGGAGTTGCTGCGGTCTTCTTGTCGTTTGCCTTCGCCATCGTAATGCCGCCGCGTTTGCCATCATGCGCAATGGCTACG
TTTCCTTCCGCGTCGCTTCGAGGCCACTAAGGTTTTTTCACTTTCTTGCTGCTCGATTTTCTTCATAGAGAAGAAGAAAAAACCTTGTGGCGAATCTTCA
TTGTAGGTTTTTACTAGCTGTGAAAGTTCCATGGAAAACAACAGTAATGATAAAAGTGCTGTGAGCGAG