Description :
From Genome Similarity Track
Location :
Scaffold_119:39016- 44087
Transcript NameFunction/comments
Hyaar_Emoy2810143metallophosphoesterase, partial
Hyaar_Emoy2810144hypothetical protein
Hyaar_Emoy2810145hypothetical protein

Sequence
5071 bases(100 bases per row)
CTTGACTTCAAATCCGGCAGTCGCACCTCCTTCAGTCAGTCTGGTTGATGTGGCAAAGTATCAGATCTACGCAGGGCATTCCTCGCCCTCCGTGCCATCT
GCCGGAACATACCAGCAGTGCTTGGTCTCCACTCCACCAACAGTCGTCTCACCAAAGCTCGAACCAAACGCCCACGACGTGTCAGCCGTGTGGTACTCCA
CCTTGAGCCATTCCTCCGACGCCAAGACCGAGAAGAAGCCATACTCGGCGCCTGAGAACGTCCACATGTTTTCGATGTATTCAGCCGCGTACGTCGTGAG
GGCACTGGCAGACTCCTTTTGCGTACCGCCACCAGCACCGTTTTCGATAAAGTGGATACCGAGTAATTTCGAGAAATCGTGCTTCTCGCCGTGCGTGTGG
CCATACATCCACAGGTGGATCCCACTACCCTCCAGAATGTCAAACCACTCCTTCATGCCGTTTTCATCGTAGTGCACACTCGGACTGTAGTGGCTGTTGA
CAATCTTCCACGTCGCCTTCGACGCCGCCGCTTTCTCTGCCAACTGCTTGCGCGAGTCATCACTCCATTCGGTAAACTTGGCAAAGCACGCGTCGTACAT
GTCGTTGTCGCCACCAGCACAGTACTCGCTTCCTCGAGACACGCTTTTGCACTTTTTGTCGTCTCCCTCTGTGTAGCCATAGCACTGGCAACATACCTGC
AGTGCAGCGTGGACATCGGCGTCTCCCGAGTCCACATTGAAAATGTCAATGCTCACGCCCGACGCTTCGTCCTCAATCGAGTGGACGTAGAAATGGTCCT
TGAGCACCCAGCGATCGTCGTTCGGACTCGTGTACTCCTGCTGCCACTTGAACTTGTCGTCCAAAGCAGCCACCAGCTCGTCTGCGCTCTTGCACTTGAC
CTTGAACTCCCCGTCCGAGCAAATGAAGCTCGCTCCACCATAGTCGTGGTTGCCCATTACGTTCACAAAGGGAATGCCAGCCAAGTTCTTGCCTTGGAAT
TTGCCTTCAAATGTCGTGGCGAACCGCGAGTCACGTTCATTGGCGTTGTCGATGCCTGTCCAGTACAAACTGTCCCCGTGGCCGAGAACACAGCGAGGCT
TGACACTGATAGCGCCCGCTTGAGTGTCCATGATACTGGCCACGACATCTTCAGCCACGACGTCATAGTTCGTGAACGTGTCAGAGCGACTGCAGCACGA
ATCACCAGCCAGGGACATGCCCCAATCACCCACAGCCAGAACTGACAAGGAATAGGTCGCTAGAAAAACACAACAGAAATAGAAATAACATAGAAATAGG
CACCCACCCACCCAAAGCGAACATAGATATCACAATTTTGTCAGGTATTACACATAGTATACACAAAATAGACCCGTAATAAGAACAGTCTTTATTTACT
GTACCTTTTGTGGGGTCGGATGTCACGGTGGAGACCGTTGAATTAGAAGTCCCAGAGTTTGTCGAGTTGCTGGACCTCTTGCGAGGGGTCGACCCGGTGG
TGCCGCCACTTCCGTCAGAAGTGGGCGAGTCACTTGGGGACGTCGAGTCCCCGGACGAGGTAGAGCTCGAGCTGGACGAAGTGGCGATGATCACGCCAAT
GATGGCGCCGATTACCGCGCAAAGTACGACGACGCCAATGATGACGAGGCGCTTATTGACTGCCATAGTGCTACTTCCGCAATGGAGGTTTGCTGATCCC
TACGAAGTTGTGAGGGGATTGGCTGCTATTATAGGTGTCGACTATATATAGTGCTGTACTGTTGACTGATTATTGGTGTCCACAACCGCCGCCGACTTTT
GAAGACTGACTGGCTAGTGGTTCAGGAGGATGATGACCTCCGGACGGCGAAAAACCTCGGATGGGAAAAACCCTAGACCTGGGATAAAGTATCGTCGGGT
CTGATTTTTCGCTCCTGAGGTTGGAATAACCCTCTAAGGAGGAATGAAGGGTCCGCATAGAGTGTCGAGACGAAGCACGCGTCGATTCTTCTCTCACGGC
ATACTTGACACGGCTGATATAGTTATTGAGAGGGTCGTCGGTCGTGACAGGCTCCTATCGAATGGGGAGAAAAAGCCTAAGGGATCAGTAGTCTTGAATT
GGCACCAAGACGGTTGCCCTTCCTGCTCGACGGCTACTTTTACGAGATCGTGGCGCGACATCGTCGACGGTCAATTGTTACGACTGAATGTGGCATTAAA
TTGACATCAATGTGGACCATTGCGATCATGACGTAGGATAGTCGTTGGAAGACGCCGAAAACGATCCTGTCGTTCAGCGCCCTGTGGATCATCCATAGTG
CTGCAAGACGTTGGACACTTGAATAAAGAACGCGGTGCCGGTGTTAGCATTCCAATCGAATCCAATCCAACTTTTGCAAATACAAGTCTAATGCACAGTA
TCTCTAGGCTAGATCTCGACAAGTGTATGGATGAATATTCGGTGGCGGATGGACAAGCTGCTGAACGCTCAGTAATGGCGGTCTTCAACTATCTTGTTAC
TGATGAAGATACGAGCGCGCAATGAGACAGATCGCTCAAAAGTGTTACAACATGAGAGGTAGCGATTAACATTCAGTGCGGAGCAAGCCATCTTGTAGAC
TAACGGCGTATCGACTACGACTGATGATCACTGCTGCGCGCCAACGCATGACCGGCATTTTATTGCTGACTTTTATACACTGAGGGGGCGATAGAAGCTC
GGTGTGGTATGCTCATTAGCTAGCAAAGAGCGAGCCACGTTTAACGATCAACGACAAGCGCTATGACCGCCAGTTTTTACACTGAAGCGTGTTTGCTATT
TACTTAGTGTGAGCTGGAAAGTAGCGCAGGATACAACACTGGACAACCAGTGTGGAGCTACTATCACCGACAGCAGCGTGAGTGGTGCCTTGCTACCTCT
GTTAACTCGGCAGAGGAAGGGAAAGCAACTAGGAACTGACTAGTTGTTGGTAAAAGTAAAACTGTATTAAATATAATTAAGTCCTAATCACTAACCTATG
TTTTAGTCCTAACTTAATTATATTTATCTACAAAAATGTATGCTAAAGTCTTACTCACCACTCATTGCGCGCGTCCATCGTTGATTGGACGGCTAGAGCT
GGCTGATATGATGACCTATATCAGCCAATCGGTGAGTGTTTCTAAATATTACCCCCTATGGTAATATTCCTGAACATTATCAACCTTTATGATAGTATTC
TAATTAACAAGTATCAAGGGTTTAATTACATGTAACAGGCTCACCCCGTTGCGTCACCCCCCCCTTAAACGATAATCACTCAATCACTATCATGTTGATG
TGGTCACTGTTAGACCACAGCAGGGACAGGGAGCACTTGTTTTGGTCTGATCCATTCATTTCTGTATTTACATCGCATGGTGAACAACTCCATGCGATGC
GCGGCGAAAGCTGCTGAGAAGGCAGCTGCGCGTGTTAACGCAGCTGCTCTTGACGATGCCCAGCTTCTCGCGGCAGATGATGCTTCGTCTGCTGCCGCTG
CAACTCTTCCTGCAGCACCAGTTGCTGCAGATGCACGTGGTGACTCACCACGTGCTAATGGTGATGGCTCCAAGTGGAGCCTATCTATTCGGGGAAGTCG
GACGGTGGGTCCGACTCGAAGACGACACCTAGGTCACCCGAGTCTATAGGAGCGGCCGAATACGAGCCTACGAATAGGAATCGAGCGGGTAGTCAGAGTC
ATGGTCACTACCAGAGTCTGTTTAGTTCGGAGGATGAGCATGCCGACTCATCGCCCGCGTCTGCTGCTGCGTATTCGCCTTCTGGCGAATGCGGTGGTGA
CTTGCACCGTCGTGATGACGATTCTAGTGGTACCAAGACTTCCGTTGGTACCACGCAGGAGACTCCAGACGGCAATGTGCTTCGTCTAGCCACTGAACAC
AAGCATTGTGTATTACCAGAAAGGCTTGTGAATGACCTGTCGGGCGAGACAAGTCTCCATCATCAAATTCCATTATTCGATGCGAGGCTGTTGCATGAGC
TCGACAGCAGCGCTAGTAACTTTCGCGCTGAAGAAGACTTCGTTCTGGACGCTTTTCTGAATCATCGTTGGTATAGTGTCAACACTAAGCGAGACGAAAG
CTCGTTGCTGCGGATGTGGAATGCCTTCACACTCAATGTGCAGCACATTGGGCTCGAAGCTTGGCTTCAGAAACTTGACACAGCTCGTGTTAGGTTTGAG
AAACAAACCCTAACTAGTGCAAAGCCAGGTTGCACAATCTGTCTCGTGAGGCAGGAATTCCATGCCTCACGTGGAGCGACCCGTGTCCGTGTTGTTTCGA
CAACACTCAACGCATCCAAAGGGATGTGTACTCCCTTTCTTCGCCCTGGGGTAGGGCGCACATCGATTCTGAGATGCGCGATGCAATTGCTAACCTGCAA
CCGCTCTACCAGCGCCATGGGCGCGTGTTTTCCGATGGACCTTCTGAGACATCGGATGTGTCTCGTCGTACTGGTGGACGAGACCCTCAACGTCAATCAT
CAGCTGGGCGAGAGCCCCCCAGCTGTCGTGCGACGGCGGATAGCCGCGCCAGCGAACAAGATAACTCTTTCGCTGCCCCTTCACGTCACGGTGGTTCACG
ATACTCTCTACGTGAAAGCGTTGGCCATCGTGCGAGTCCACCAATGGCTGTGGTGGGGACAGGAATCTCAATTCGGAATCGTTTTTTGGAGTTGCAGGCG
GAGGTTGGTCGTCTCCAGCAACGCTTGCACGATCTGTGTAATCATACCGAACAATAGAGGCAGGAGCTTCTCTCTTTGGAGGTGTGGGTGCAACGCATCC
GCCTTTATCGATCGGACGACCGATCGGAGTTCGTGTTCTACCAATTGGAGAATGAGTGGAGGCGTCAAGCCTTTCGAGACGAAGTGGCTGATCTTCGTCG
CCAGCATGCGACACTACAGAGCCAGATTGAGAAACTGGCTTGGGTCCAAAAGAATCTCTAGTGCGCACCGCTAGGAGGTCATCCTCTTTTTCAGCGAGGG
TGTTCTCATCCTTGCTGGTGTAGTCATTGGCGATGCTAAATATACCAGCATCTTAATCCTCATCTGGGTCA