Description :
From Genome Similarity Track
Location :
contig_57:39014- 40553
Sequence
1539 bases(100 bases per row)
CCAACGTATCATTAAAGATCCTTGCCCTCATTTGTGTTCGCTGTCTGGGTACCGCTAATGTCTCCATCGGGGTCATGCACAGATCATATAGCCTTTTCGG
CTCAGCAGATTCTATGGTCTCCTCTTGTTCCATCCCTTTGACCACTGCCCCAAGGTAGGAGATTGGTTTGCTCTCGCTTTAGTGCTCTCCAGCTTCGTCA
ATTGTAGTCTCCGGATCCACGAAAGTGAATAATCACAGTCTATCATCCAGCTCACCTTGCGTACTGTGCGCAATTGTGATGCACGTGTGCATCATCTGCT
GTTGTCGCGTGAGCACGTGCTGCCTTGCGTTTGTTCCAATAACCCGGAGTCGGCGGTACTTCAGCTCCATCGTCTCTGGTATCGGGTCACTCCATTTCGT
TTTCTCTGCTTCGGATGGCAGCCCAGAATCCTTCTCTTTCAGCTTCCCCAATGCTCTTGGAATCGATGCTGTCTCGCCATGTCCGTCAGTCGTAGTACGG
TGCCGTACATATTGCCTCGGCTGTGTTGCTGAGCAGGTAAATCCGCAATTATTTGAAAATCACCTGTCCGTCTCCCATATCTGCACTATTTGGCTTTGTT
CCTGGGGTTCTCAGATTCCTTCCTTGATTCCTTCTATCAGCCAGTGCCGTCGTGGCGATAGCTTCCGTCCGCTCTACTTGTTCATCCTTGCGCGCTGCCG
TGTTGTCCCGCTCTCCTTCCCATCTGCCGTTGGACGGCCTTTAGTTCTGCCTACGATTCTCCCCTCGCTTGCCGCATTGGTTTTGCTCTCCATCATCAGT
AGTCACCCTTGAAACCTCGCGTTCTGCTCGACCTCTTGTCCAGCCGGCCCCTGGTCCTGCTCGCTGTGCTCAACGTACTCCCAGCCGTGATTTCCTTCGG
CGATCTTTTCGTTATCTGTCTTTTTTGCCCCCCCCCCCCCCCCCCCAGTAACCGGGTCGGTTGTTGCTGTATTCGCTGGACTTTGGCCCACGAAGTATCA
GTATCAGTATCGTGAGCGGGAGCCGGCGGATTTGGATGATGGCCTACCTTACGCACACGTGCCCTGAACAGACAGCTCCCGCGAAGAGAAACCATCGTTT
CGGCACACACACAATAGAGGTTCCGCAGCCCAACCTCATTAACCTACGGCCAGGTACACCGCGACCGTCGTATCCGATATGAGGGCGACCCCAGACACAA
TTCAACACGGGGTGATCCCATTTCAGCATTCGTCATCATGAGCGTCCGTACACCGTAGACGAAGGGGCTAACCAACGATCTGTTCTCGGCAATACTCCGG
ACGATCAGGTTATAAGTGCTCAATGACAGTCAAGGCAGTCCATCAACACAGCCCACCAGTGTGCAGGCACTTGGTGAGAGTGAGCAACAATCTGTCAGCC
TAGCGCTCTGGTGTGCACGTACTTGGTGACGACAGTTCCAGTTCGGTGACTAGATCTCAGTCTCTCATTACAATTATAGCGGTGCACAAGGTGACAACAA
CCGCCAGCTCATCAGCACGACATCAGCATTATCAGCGCT