Description :
From Genome Similarity Track
Location :
Scaffold_39:390113- 394192
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011938Similar to PPE1: Protein phosphatase methylesterase 1 (Candida albicans)
Pytul_DAOMBR144PYU1_G011937Similar to NEFM: Neurofilament medium polypeptide (Bos taurus)

Sequence
4079 bases(100 bases per row)
GCCCTGAGTCACTGGCAGACGACGTCATCCAGCTTCTGAACGAGCTGCACGCCAAGCACCCTCAGAGCGCGTTCATCCTACTGGGCAATTCGCTGAGCGC
CGGCACCATGGTGCTCGCTACAACCCAAGCCAAACACGAAGGAATCAAGCTCAAGGCGCTCGTGCTGCTTGGCCCAGTGTTGCGCGATTCGCCGATGAAT
ACCTGGTTCCGTCCGCTCTCGCACGTGCTCTTCCGTGAGCTCTACGGCGCAGGTATCTGGCTGAATTACTACAAGACGCTGTACCCACCAGGAAAGGCAC
CCGATGACCTGGAGCAGGAGATACAGCTCTTGAAGACCCACCTGAAGGCCAAGAAGGCGAATGTTGTGAACACTGGCCGGTATGCTCGTGCGTCCAAAGC
CAACGTCGCTGCCGCGGTGAATAATGAACTCGGCAAGTTTTCCAAGATCCCCGTGCTCGCGTTTTACGGCGGGAAAGACCCGGACTATGGCAACTTGCAG
GAAGAGCTCGAGTGGATCAAGGGTGCTGTGCCGCACGTGACGTGCTTTGAAGACCCCGACGGCGGCCACTACCCGCACGTGGAAGATGCCCAGAAGGTGG
CCAATGCGATTGCGAAAATACTGTAGCTGCCTAGGTGAGCACCCTCGTTCACCTGCACTAGTTTTTGCAAATACATATACAATTTTTTTGCTTTACTGAA
TAGGTTCACTATTTGTACGAAAGCGACACACTGCAAATTCTCTGGGCCGTGAGGAATTGCCTTGACATGTTACATTGGCACTACGCGAGAGCTGCACTCG
TGCTGCATGTTGCAATTACTGGATAGATCCACTTCGTCCATGCTCAACAGGACGCTTTTTATAACTTATCGATGCCGCATGGTCTCTTCACATGGATTCA
AAAAATGCACATGGGTTCATAAAATGACGCATGTAATACCAGGTCTTCAACCAATCCATTCTCGATGCAGATCCTTGGCGTGAGTGCTGCTCGCTTGTTG
TGTGCATGAAAGGAGGAACGGCAGACATCGGACCAATGGCTAAGTACACAAAGGACATGGGTTTACTGACGATCGGATTATGGTCGTCAATCCAGGCAGC
GCAGTTTATTTCTGAAAAAATGCACGAGTGTTGTTGTGTCTGTTGGATTTTTTTTCAGTGAGTGTGGGTCTGGTAGGCTGAAGTCTTTTGTGACTGTTCT
CGTTTACCCCCTACTATTGTCATTTTATTTTCCCTAATTTTGTCACCTTTTCTAACTACATTGCTGGTATCTTTACCGAGAAGCAAAACGATGCTAATCC
TCTTTTGTCACTTTGTTTTCTTAAAAATTGTTCCCCCCTCTCTTCATGAAAACTACGGTTTCAGTAGGTTCTTGTCCCCTTTCGCGCTTGGAACACTTCA
ACTCTCTGCTTAGGTACGAACTCATTTTTCACTTGCGTTCAGTATGTCGGCGCTTTTGGCGGGAACCTACAGTCGTTTCAAGAATTCTGCACCAAGCAAA
ATAAATTTCGGTAATTTTTCATCCACTCGAAGCTTTCTCTCCCTCGCGATATTAAAACCCGCAATGTAAAAAACCTCGTCGTCACTCAAGAAAGAAAGCG
AAACCGCTTGTCCCATGTCTCTACGGTACCTATCTGTTTGGTTGTGTGGGATCCAAAGGACCAGAAAAACCTTGAAGTAGGATACCCAAGGTTTTATTCA
AGTGCGCGCAAGAGGTGGCAACCCTTGCATTTTGCGCGCGCGCGCAGAAAGAAAACTACAGCCGCCCGCCACCCACAGTATCGCAAAACCGACTTGAAGG
GAAGCGCCGCCACCCGCTATTCCCATCGCATCGCAATCCTATCAGACCTGTCGTAGGAAGGAAGGAAGGCGCGCACATATTAACCGCACGCGATGACGGA
CGCCGAAGTCGTGACACTGACGTCGCGCGTGACGACGAAGGCGCAGCGCCAGAAGCAGCGCCGCGCCGCCGGCACGCCCTACGGGGTCGCGGGCTCGCGT
CGCAGCCGCCACGCCGCCCAAGCGGACGACGACGGCAAACCGCAGCAGCGCGGCGGACTGTTTAGCCGCTTTCTGAGTTACATCCCGATCGTGAACCAAC
TGGTCGGCGATGACGACGCGTTTGACGGTGAAGAGCACGAAGACGAGGATAACGAGTTCACGGACAGCGACGACGGCATGCAGTCGGTGACGGAAGAGGT
CACGACGACGACGACGACGGTTGATGTCATGGAAGAGACGGTCGTGTCGACAGAGAACAAAGAAGAAGGAGAAACTGCTCATGAGAATATGCAGAAAGAA
GATCAGCAACAAGATGAAGAGATGGACCAGCAGGCGGAGGAAGACGACGAAGAAGAGAATGAGACTACGTCGAGCGCGACGAAGGAGGCGAGCGAAGCGG
CTCACACGATTTCTCCAAAGAAGCCGGTGGGTGGAATTGCGGCTACGCCAGAACGAACCGCGAGCTCGCCATCCTCGTCGAAGGCACCATCTACACAATC
CTCGGCGTCGAAGTCGCCAACGTCTGCGAAGCGATCCCGTTCGCGCGATGTGGAACTTGGTCCTGTGCTTCGAACGCAACGACGGAAGAACAGCAGCGCT
CAGAAAGCGTTCCTTCCTATCCCTTCGCAGAAATCCAAGGCGCTTCGTATCGGTGGCCACGAATCGCCGGATGATGATATGCGCCGTGCCCACAGACGTC
GCCAGCGACTTTCTGGGTCGCCAATGGACTCCCCATTGGCTGTGATCAAGCACAAAAGGGCTATCTCGTATGAGGAGTACGAGCGTCTCTCACTCCAACT
GCGAGGATTGGTCGACTCGAGTCCTCAGACGTCATTGGCGCTCACACAAAATGCGCTCGCACGAGGCTTTGAGGATCGACCAATTGGATCGATGGCCAAC
GGAGGTTCCGGGAAGAATCTGACGTACGTTCCTGGATCAATGACTTCGAGAGACAACGGTCGAGGTTTGGATTTGGAGAAGAAAAACAATGACTCAAACG
GCGGCGACCTTCAACTTGCTGTGCCTTACGGAAAGCGAGCGCGTTCGAACGAAAACCGACCGATTTACTTTTCGGGTATCGCGCTTCGTGGCCAAATGCT
GACGCGTGAAGAACGTGTGGAACGAAAACCGCGCCCTTCGCGTCTGTTGACTGGTGTGAAGCGTGATGCGGCAGCTCGCAGTGCCTACTCCTCGGCTGTT
GCTGAAAAGATCTTGTCGACGTTGAACAAGGTTCAGAACCCGCTCGAGCGCGAAGCTAAGAAGCCGACCCCACAGACCTCGCTGTCTTGGGCCAAGTACC
ATCTTGCGCTCACTGACGACAATGAGAATGCTCTCATGCAAGATGATGAGGAACCGCAAGACGATGCTGTGCCTCCAACGGCTACTCTTCCTCGCGTGAA
TTTCCCATCGTCGCCTGCCAGATTAACTACAGTTCCTTCCAAGTCGCTGAGTGTGATGCAAACGCCTGTGGTGAAGTCGAAGGCTTCTTCAGCGTTGTTT
TCTCCTCAAGCTGTATCCATGACCCCTGCGTCGGACATGCGCGCAATCGTGAAGCAAGGTGGTTTGAAAAAGTTTGGCACCTTTGCGTTTACGATTCCAG
TCCGTGATGGTGATGCGCATTTGAAGAGAAAAGCATTCGAGATGGATGTGGACGATATCCAAATTGTGTTTTCTCCACCACCTTCCCAGCGGGAGCCACC
AAAGAGAAATTCTACGAAGAAAACTACGAAGGTGAACGGTGCCGTAGAGGCTCCATTCTCGTTTGTTCCTGCGTCGCCAAAAGCAAGAACCGACTTTTTG
TCCATGAAGTCGACTACTAAGGTCGTAACAAGTGTGCCGGCAACTGTGAAGCCAGCGGATGTGTCGGTTGCCACAACTAGTTCCAGCTCAGAGAATCCAT
TGGCTCGATTTACCAAGTTGGCTCCTGGCAGCTGGAAATGCCCAACGTGTTCTGTGACCAATGAAGCGACTCATTCCAAGTGTCCATGCTGCGAGACGGC
GAAGCCTGCAGGTGCTGCTGCCCAAGCCACCTCTACTAGTGCTGCTTCGTCTAAACTCTCTGCTCCAGCAATTTCCAGT