Description :
From Genome Similarity Track
Location :
Scaffold_243:39006- 42973
Transcript NameFunction/comments
Phypl_g5846hypothetical protein

Sequence
3967 bases(100 bases per row)
CTACcggacctcctcgtccgggaGCTCGTCGCCTGACTGCATTGCTCGGAAGCGGACTCGGGCGCGTTCTCCTCGGTCGAACTTGTACAGGAGGCTGCCG
CAGTTCAGTCGCTCTTGGGGAATCCACTCGGGGATGTCGTAGTCTTTCCACTTAACCTTGCATTCTTTGACACGTCGACTAGTGCGGGTCCTCGTGATCC
AGCGTACATCCAGGATGGTCTCCACTTCGTATTCTCCAGCATTCTCATCGGGTTCCGAGCTATCTTCTCGCAACAGCGCAGCATCGAAATCGCCATCCTC
GGGCATCTCTTGGGTCTCAGTCGGTCTCTCGGGGAACACCACTCGGGGTTTCAGCCTGCTGACGTGCACCCAAGGAAAGAACCTGTAATCAGTCTCTTCG
ACCTGGAGCCGATAACGGAAGTCGCTGCCCTTNTGGTTGTGTTCCCGAGCCCGCCGGGTCTTTGCCTTAGCTTGGAGGTCTCGGGCCCATGCTTTGGCGT
ACTCGACTTGCCGCTGGACCTTGATTCGCCACTCGTAGGcatctcggagctggacgtcTCGGGGCACGTCGCCTATCATCGCTTGCACCGTTCCTTGGGC
ATACCAGCCACGCACCAGGTAGAAAGCGGTCTCGAACCGGGTAGCATCGTAGGACGTGTTCAGTGCCcacatgagcttctcggcgagtCCGTCCCAGTCA
CTTTGGTCGACTGTTTGCACATAGGCTTGGACACTCCGGATGACTGTCTGGACGGTCCTCTCTTGTTGGCCGTTGGCTTGGGGTCGATACGCTAGGGTCG
CACGTTGACGACTCCCGAGCATCTCCCGGAAGTGCTTGAAAACGCGTCCCATGAATCGAGGGTCTTGATCGTGACGGATAAACTCACTGGCGCCGAATCG
CCGGAACACGCACTCCTCGTAAGCTTCGGCTACATCTTGAGCAGACGTGCGCCCCATGGATTTACACATGATGAAACCCGAAAAAGCGCACTGAAAGAGG
AGCAGAGCTTCATTGCCCCGGGCTGTCCGGGGAAGGGGGATGACGAAATCCATGGATACAACTTGGAAGGGCCGGGTCGCTAATATGTTCCCAGGGGAAG
GTCCCGGGTTCCGCAGCAGGCCTTTAGCGGTCACGCAATTCACACATCCCTTGACAAACCGTTCGGCGGACCTGAACATGCATATCCAGTAGAATTCCCG
GCGCAATCTCTAATACGTCCTGATGATCCCCTGGTGGGCTCCTTGCATGTCAGAATGGCAGTGATGCAAGATATCGACCTGGAGATCTCGGGGCACGATC
AACCTAAGCCGATCTGCTTCGTTCTGGGGGCGTTCGGGGGTGTTCCGACTGACGTAGAACAGCGCATCCCTGCGATCCAAGACGAACTGGCCAGCAATCG
TGGCTAGGTGTGCTGTCTGCTTCAGCGCGAGCTTCTCCGTCTCTCCACGGAGGAAGTTCATCAATGGCCGCAGTTCCGGGTCAGATGCTTGGTGAGCGCA
GATCCGCCTCCAGCATTCCTTCCTGGCTTCTCCTGAGTCTTCTTCCGGCTGATGATACTCGCGGCTCCTGGAGTCGACCGCTGTTTCGccctcttcttca
tctgaATCCGTCGGGATCGCGGTGTCAGGCGGGGCTCggggcggcgtcgtcgcctccggGGGGTCTTCGTCGGAGTCTGCTTCGGCTGGTGCGGCTCGGG
CCCGGTCCCGAGTCGTTACGAACGCATTCGCTTCCGGGGATTCTGCTGGAACGCCGCAAGGGCCCCGAGCCGTAGCCATGAAGGCCGATTCCACAAGTGA
TTTCTCCCTCGGGGCCGGCTCTTTCATCAACGTTTCATGGATTCGGTTGAGGCCTTGGAGTAGTTTGATCTCTCCCAGATCATCGACCTCCAGGAACGTT
TGTTCTTGAAGGATTCGCTTGGAGACGtagtctgcagctgcattgAAGTCTGGTTTCACATGGACCAGGCGTAGAGAGATGAACTTACCGTTTAGCTCCT
CGGTCTCCTGGAGAAGTCGTTGCAGGTGCGGTTGTGTACATCCAATCACTCCTTGCAATTGCTGAATCGCTAGGCGTGAGTCTCTGACTACCACTATATC
CTTGACATCTCTCTCCAGGGCCAAGAACATTCCCTTGATCATTCCTGCATATTCTGCTTCGttcatcgtcgccttcgtcagGAAGTGTCCTTGGGCTGCT
ACGATCGCCCAGACCGGGAGTTTCCACAGGATGCATGCGGCTCCCCCGGACCCACCTAGCTTGGCGGCTCCATCGAAACTCAACAGGTGGCCTACGTGGT
CATTGGAGAGCATCTCCAGGCTGACTGGCGGTGTCTTGATCCGGGATCCCTTGGAGGGAATCTGTTCTTCTCCAACTGTTCCCGGGGCGTGATCCGTGCA
CCCAAGGTCGCTGCGAGACCGTCTTCATCACGCTCGACTCGCCGGATATCTAAATCCCAGGGCGGCAAGTTGACAGCCCACTTCAGACATCTCCCGTCCA
CAGTCTTCGACTTGAACAGCCATCCCAGGACCGAGTATCGCGTGTANTGAACAGACATCCCAGGACCGAGTATCGCGTGTACACTCGGATCGTCTTCTCG
GAACCTTTCGTGATCATGGTATGACAGGTGTTGAGTACTCGTAGCAGGGCGAGGACTTTCTTTTCAGCCGGGTGATATCTCAACTCAGTGTCTTGGAGAA
CGCGTCCCACGAATCGTACGGGTCGCACGACACCATCATAGTCTTGCCCCAAGACGGCGCTGATGGCCCACTTGTTCGCATGCAAGATGATGACATACTG
CCTCTCGGGGTCCAGGTGCTGTAACGACGGGGTCGACACCAGGCgttccttcagcagcttgaacgcaTGTTTGACCCGGTCGAGGTCGCGCCCcgagcgg
agctgctcatcgGACAACTCGTACAGTACCGCCGCTATCACTGGCAGGTCTTCGATGAACTTGCCGTAGTAATTGAGACTTCCCAGGAAGGATTGAACTC
CCTTGGGTGTCTTCGGGAACGGCAGGTCCAGGACTTTCGTGGCGAGCTTGGGAGACGTGCGGATTCCATCCGAGCTGATATCATGCCCGAGGTACTTGCA
GTTCTTCACACCAAACTCGCTCTTCGGGAGGCTGACAGAGATGTTCCAGTATCGCAGACGGTATAACAGAGCATCCAGGGTCTTGCACAAGTCGTCCCAG
GACGGGGCTCCGTAGATAATGTCGTCGATGTATGAACTCCGGAACATAACAGGTCCCATCTGCTCCGGGGAAACCCGGTTCTGATGGAACCCTGTATCGG
TGCTGGTTCGAGAGACAACCGTCCCCTGGGGCTCCGTTCCCTGGGAAGCTTGGGCGTCGGCATCTTGGTTCAGTCCCAGGAACTTCAACACGTCGGGGTC
CACCAGTTTCTCTTCGCCCGGCGAGAGTCGGACAAAACCCCAAAGACCAttggcgaggagctgctgataGATCAGCGGCGCATTCTTCAGACCGAACGGC
ATACACTTCCACTGGAAGTGCCCGAGGGGACAGATGAAGGCTGAGATCAGCTTGGCTCGGGCAGTCATAGGGACCGCCCAGAANTAGTTCATCAGCTTGA
CCAGCTGATTCCCCAGTCGATAGTCGATGCACAAACGGATATCCTTaccgttcttcttcatcacgatGACGATCGGCGATGCCCAGGCCGAATCCGAGTA
CTCGATCAAACCCGTCTCCAGGAtccgcttcagcagctcgtagacATTGGGTAACAAATCCCCAGGAATTCGCCGGACGCGCTGGGAGACAGGTTTCGAG
TCGCCGACATCGAGGTCACAAACCACTCCGCGGGCAGGTGACGGCAAGGCGTTACCTTCGCCGAGGAAGATGATCTTGCGACGCCGCAGGATGATGCGGa
gacgctcttcttcctcgggGCCTGTCTTCTCTGGGTCACCAACAACTGcttcgtcgatcttggcctc