Description :
From Genome Similarity Track
Location :
Scaffold_1193:390- 10045
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1193-snap-gene-0.5EREBP-4
Pytiw_DAOMBR242034maker-piw_contig_1193-fgenesh-gene-0.1TPR repeat-containing protein DDB_G0287407
Pytiw_DAOMBR242034maker-piw_contig_1193-snap-gene-0.8Ferredoxin
Pytiw_DAOMBR242034maker-piw_contig_1193-snap-gene-0.7Conserved gene of unknown function

Sequence
9655 bases(100 bases per row)
GATAGAGAGAGAACGAGAGCAGCATGGCGCCCCGCACGGCTCAGACGCCCGTGTTCCTGAACGTCTACGACCTCTCGCCCGCGAACGCCTACGTGTCTGG
TATGTTGGTGTATTGCGTCGCACTTCTGTATCGATCGCGACGTTCACACAGCCTTTCGTGTCTTTCTCAACGTAGCTCTTGGAGTCGGGCTCTTCCACAG
CGGCATCGAGATCGCGGGCGACGAGTACTCCTTCGCGAGCGGCGCGGGCGTCTTCACCAACACGCCAAAGCAAGCTACAGGTGCGGCTCTCATTGATTGG
ACCCATTGGGGGTGTTGTTATGACGATTAGAGCTAACCACGCACGTGTGTATGTCTAATATTCACGACAGGCGCTGTTTTCAGAGAGTCGATAGAGCTGG
GGGTCTTCAACGGCTCGTACACGGACGCACGGAAGCTGGCGTACTCACTGCGACCCGAATTTGAAGGCGGTAGCTATAATCTACTCACAAAGTACGCTGC
GCTTTGAAGAATTGGTGCCAGTTTGCGGGTTGTTACAGGACTGAATGAACACTATGATCATTGCTGCCATACTGATTAGGAACTGCAACGCGTATTCAGA
AGCGCTCTGCCAGCTGCTGCTGAACAAGTCCATTCCTGCGTATGTGAACCGCGCAGCGTACTTTGGCTCCTTTTTGAGCTGCCTGATGCCTTCCGATATG
GGTTCGCAAGCGCCTGTGGGCGACACGGGCTCCTCTTCGTCCTCGTCGCGTCTGATCAGTGGCCAGTCGAGTCGCTCGGACTACTCTGCATTCGCTGGTA
CGTCGCATCTAGTGATGTTCACGTCTTCATGTATTGTTTAACTGATCGAATTGCTTCTGTGCAACTGAAGGTACCGGACTCACCCTCGGTGGTAGCTCCT
CTTCCAAGTCCAGCAACACAAATGACGCGTCCACGCTCGAAGACCGGCGCGAGAAACTTCGACAGGCGGCGTTGCGACGCTTCGAGAACCAGAAAGAGTA
ACTTTGCTGGGCTTCTTGTATGCTCGCTGACTGCAATGGGCCCCCAAGGCACCAGCCTTTTGAATCTTGACTCACATCTTTTCAGCATACCAACATAGCA
TCACGACGCCCGTTCGAGTGATATCCGTTTCATTCTGACCCCCACTTCTTGCACTTTTCAAGGACAAGGTGGTGTCAAAGATCGATTCGAGGCGTGATGG
GAAAAGCTGCAGCGTCGCCGGCGAAGAAAAGCGCTGCCAGGAAAACTAGCGCCAATGGCGCTCGAGAGCCTGTGCGAGCGCGCTCCTTCGACGATTCGCT
ACTGGTGGAGCGCATCGAGCGCGTGGAGAGCACGATCGTGAACCGAGAGACAGCGACGCACGTTGCGTTCGCGAAGAGGTAACGTCATTTCCGCTGCATG
TGTATGCATTTTTCAATTCTCTGCTTCTGACAGTGGAGTCTGTAGCCGCAAGGACGACTTCGTGTTCGCGCCGTCGCCGCAGTGCATGCACATCCTGAAC
GACTACTGTCAATGGGACCGTGACACAGCGCACTCATCGGTGTTGGTTGTGATCAGCCAGCCGGGCAACGGCAAGTCGGCTCTGCTCGCGCACTGGGCCG
ACGAGCGACGCAAGTCGGAGGAGGGCGTGCAGGAGCTCATCTACGACCACTACTCGGGCTGCTCGTACGACAGTGTCCGCCTCTCGCTCTTCCTCTTTCG
GTTCATGAACCAGATCAAAACCACCTACTCGCTTAAAGACTTTGAGCTCCCGCGAGAGCACGAAGAGGAGAAGCTCAAGTTCTCCTTTGGACGGTGCCTC
GAGGCGGCAGTGGGCAGGACCAACCACCTCACGGGCGCCAACTCCAAGCCCAAGCGGTGCGCAACTGACGAGATCTAAGTACTCTGGCACAGTACGATGA
AGCCTGAGGTTCGCTTTGCTTGTATGTCAGGATCATCCTCGTGCTGGACGGGATTGACTGTATCCGGAATGAAGACGGCGGCGACTCGCTTTCGTGGCTC
CCGACGACCTTCCCCTCGAACGTTCGTATCATCGTGTCTGCCACGCAGACAACTGCACGAGGGACGAACCACTTGCGCTGCTGCAAGCTTGTGAATCGCA
AGCCCTCCGTCTTTGACGACGAGTGAGTCACTTGTGCCTTCGATCATTTCACCAAACACATTAATAGCAACTTTAACTGACAATGTCGTGCCACGTGCTG
CAGCGAAGACCTCGTGTACAACTCCTCGCTACCCCCGCAAGACCACGACTCTCACACGATCCGAGAATTGCGAAGGCGCCAGTCGACCTTCATCGTCGTC
GAGCCACTCGATGAGCCGTTGTGTCGGGCTATCTTGCAGGTATGTGTGTGGATCACCATGCCTTTATCCTGCCAGTATGCAACATTGACACCTCGCTTTG
AAATGATTGCCTTTCTAGTTGTACGAAGAAAAGTTCTTGCGTTCGCTAGACCCCGACGAAAAAGAGGCGATCGTGACGTCTCCTGGAAGCTCGAGCCCTC
TGTGCGTACGCTTGCTGCTGCATGCGCTCGAGTTGTTTGAGTCAACGGATGACGCGCGGAAGCAGTGGCTCAACGCCGCGTGCCAAACGAACGAGCTCCA
CGTGATCTACGAGATGATGATGAAGCAGTGGAACGAGATCCTCCTGGCCGACCTCTTTGAGCAATTTCACAAGTGCAAGGCCTCAGCAGTGGGCACGACG
CACACTAGTAGCCTCGGTGCCTTTGCTGCAATGCAGAGTGGTGAGGGGAACTCGAATGAGCGCAAGCTGACACGTCGATCCACGAAGCGCGATGTCACAA
GCGAGCAGAGCGCTGCACCGGACTCTGTGGAGCTCGAGAATCTCCAAACGGCGATCGAGCAACGTGCACTGCTAGTGCGCCACACGCTATCACTCCTCGC
AGTGTCGAGGTACGGCCTCACCGACGCAGATCTAGTCAAGTTGTTCGGCGATAGCGTGCCGAAAACCATTTCCCAGCAGCTCATGAAGCTCTTGAGGCCG
CACTTGATGCAGATTCGCCGGCACGACTGCGGTCCAGCGGCAAATAACGTTCTGCCTCTCGCACCAGCAAACAACGACAATGACGCAGCAGTTCTCCTGA
ACGACTTGAGCCACAACCAATTTCGTCTCATCATCCGCTACGGGTTTCTGCGCGACGACCATTTGCGAAACTGCTACTATCGCGAGCTCGCCAACTACTT
TGAGGCCATGGACGCGTGCCAGCGACGACTCGATGAGCTGCCAGTGCAGTTGGAGCGATGCTCGCTGTGGTCGTCACTTCAGAACTCGCTCGTGGACATC
AAGATGTTCCAGCTCTGGTGGGGCGAGCGGAACCGCCAGGAGTTCTTCTCGTACTGGATGGTGCTGCGCAACAACTGCTCGATTCACGACCCCGCGGAAG
ACTTCATACGGTCGCTGGACGAGTACATTGCGCACGAGAACCCAACTGCGGACCAACTCCTCGCGTTGTTCCTCACGATCACGGATTTCCTGCGCACGTG
GCAGCGTATCGATGACTCCAAGAGCGGTCATCTGGTGAGCAACCGCCCCGAGCCACCCCAACTGCGAGAGTTCATCACGGGCCTTGGGAACTTCTCTATC
TCCCACTTGTCCGACAGCGAAGCGAGGAAGATCCAGCAGGACATTGACGCGCTCTGCATCCACGCGGACGACGCGTACTACGTGCGCCGGTGGCTCTGGA
CGCAGTTTCCGCTCATCGGAGTCGCCTTCGAGAGTCGCTTTCTAAGAAACGTGCTTGCATCTCGCTTCCCTGGAGGAGCGAATGACGCATCCGCTGCTGG
TGAAGAGAACCAGCAGCACGCAGACAGCAGTGGGAGCTCAAGTAACAACAACAGCAGCACTCACACAGCAGGCGCAAGCGGATCAAAGGGTGGTGTCGTG
CTTCCAAAAGCCGTTGTTGCAGGGGACAAGCCCAAGACAAGTCCGATCGTGAAGCGCAAGCCGCTCCCAGCAAAGACGCTGCTGCCCAACAACCCCTCGT
CCAGTGGCTTCAGCTCGCCGTTCGACGCAATCCCAGAGGACGACTTTGGCGCTTTCGAGTTTCTCTCGCCTGAGAATAGCGAGGTCTCCCTCGGATCCGT
TTCGAAGCTTGAGGTACGCTTTGTCATGGAATCAGTACGTACGTATACTACCGTCAATTAGGCACTCACCCTAGCTAGCTATCATGGATTTATAGTCACA
ACTCATGGAGCTGCGCATGAAATACGACAAGCTCAAGTTCACGGCAAAGGAAAAGAGTGAAAACCTCAAAGTACTCGAGTCACGGCTGCTGGATACCAAG
GCGCAGGCAAAAGCCGCCGGCCAGAGCGCATCCAAGATGGACGAGCTGCTCGAGCAGATCCGCCAGGTGAATGACGAAACGATGGTCGGGAGACAGCGCA
GCGACTACTACAAGTCCATCCTTCGCCACTGCGAAGTGAACCCGGCGCGCGACCCGAACACGATCGAGAGCGCCGAGACGATCGTGAACAAGCTCAAGCA
GGACGTCGTGGACCTGCAGCAGAAAACGCAGGTGGTCTCGTATGAGAAGCGGCTCGCGAGCATCGAAGTGCCCAAGCTGCTGCAGGTGATCCAGGACAAG
TCGGATATCCACCAAGCCGCACTCGCGCGGCTCCGCTGGCGCCAGGAGCTCAATCACCGCATGACCTCGAGTCTGATCGCGAACAAGATCTCCGCATTCA
CTGTGAGCAAGAACTACAGCAACACGAATAGCAACGAGCCGCTTGAATTTGGTGGGCAAGCTAGCCTTGGCTCACCTGCCAAGCGCCACACGCTTCCCAC
CGGCGGCGATGCTCACATGACGCTGGCAGTGGCTGGCTGCGAGAACAGCTTCCTCGGGAGACGAACGACAACGACCGAAGAAGCGAACTTCCTTCGTGCG
AAGGACAAGCTGCTCCACAAGAAGGAGACGTCGGCGGAGCGGCAGAAGAAGGTCGAGTCGCTCAAGCAATACGTCGGCAGCGCGTACAAGGACGACGGGA
TCCTGGGCACACTACGCCAGGTGGGGATCAACAAGCCAGAGGAAGCGCAGGTGTACTGGCAGGATCAGTTAGACCACGCGACCCAGTTGGAGGCTGAGGA
GAAGCTCGGCGAGCAGCGCGTGATGGAGTATCGAGAGAAACTCGCTGCTCTGCAGGCGCAGTTCGTGAATTTGAAGCTCGGGGGCAGCAGCACGAGCAAC
GAGTCGTCGTCAGCTGCGTTGACGACAACCACTGGAGGTACTGGGGCCAGCTCCGGCTCAGCTAGCACGACGACACCAATAGGAGGCACGACTGGTGGTG
AGAGCGTCTCGAAGTCCCACAACATCAAACTGTTGGAGCAGCAACTCGCAGAGACATCAGCAACCAACCAGCAGAAGAAAGAGCGCGCTGCGCGTCTCAA
GCTGCTCTCAGAGGTGAGAAGTTGCGTTGGTATGTTGCCTGAAGGACTGGGCTGACTTGTGATGATTCCTTCAACAGAAACTGCACCTGGGCTTGCTTCA
CATTGCGCAAATCGTGGGCGTGGCCTCGGCGCAAAAGATGGATTCGCTGGCGCTGGGTGACGCGATCGAGCAGGTCGTGCGGCTCTTCCTCGGGGACGAG
TCCCACCTGCAGTCCAACTCGTCGACCAACCTGCGCCGCAAGAACAGCGCACGCGTCATGGGGCTCGCGAACCAAGCAGGCTCCCATCCACTGCTGCCTC
TGGACACGCGCACCGCGGACGACAAGATCCGCTACAACGTGCGCGTGCTTAAGAGCCAGAAGCGGTCCATGAACCCGTACGTGGACACGAACTCGGACGA
GGAGAGCGACTCGGATAACGAGTCCAACACAAGCGCGCGGACGACGAGCGCCGACGGCGTGAAGCGGCGCCAGGATATCAAGAACCGGTCCAAGATGGAG
CTGCACAAGAAAGAGGCCGAAAAGAAGCGCGCCGAGAAGAAGCGCAAGTAGTCCAGAGATACAAACAAGAGCTCACAGGAAGGCAGACTTGTCCACCACT
CACATTGTCTGGGAGCTCTTGGATTTGGCTGCTTTGTGTGTGCGTTTGTTTCTGTATTCATCCATCGTTCCCTTTCTTTCTTCACGTTCTTCATCTCTCT
CTCTCTCGCGTTCTGTCTGTGGGGTTGATGACTCCAGCGCACGCGAGTTTATTCCTCGTCGTCGTGGTCGTCTTCGTACTCGTGGACGTACTGGTAGGTC
TCGACTGGCGGCGCCTCGGGGACGGCGACCACGAGGCCGTCGAGCGACTTGTCCAGGATGATCTCCGTACCCAGGCGGGAGCTGACAACGAGCAATAAAC
AACGAACACAAGGCCACGGAGGTCAGTCTTCTATATGAACAGCAGTCAAGAGGTTGCATGATCCAGCACTACGTACTTGGCCGAGCGGTCCTCCTCTGGG
ACGTACTGCAGGACGTGGAGCTCCTGGTCGTTTGGCGACGGTAGCTTGTCGATCCACTCGTTCGCCACGACCACGTGCGACTGCGGCGAGTTCGAGCCTG
ATACAAGAACCACAATACACACGTGAGTGTTTTTATGATACCCCACATGCGTGACAACAGGCAGCCATCCGGCCACACACCTTCGCCGAAGAGCGACTCG
GTGTAGTAGTCGGAGCGCACGGCGCTGTGGAGGCCGCCGCCGCCGTTCGAGTCGTCCTTGACGAGCGCCACGTTGTTCATCTCGCACGCCTGGCGCAGAG
TCTGTCCCTGGCGGCCCTGGATGAAGTGGCGGTTGCCTTCGTAGTCGACGAGGACGACGTTCACCCTAATGATCACAGACCACAGACCACACGTCTGTCA
ATTCTCAAAACGCTCCCACGCCACCAATAGCTCGTATGAAGCACGCACACTTTCTCCGCGACCGTGGGCGCTACGTCCGCAGGGGCTGCGAAGCCGCCGA
TGTGTCGTCGGCTCACGCTGCGGCCGAGGGCCGAGGCAGCACGCAGTCTCGCCAGCATCCTCCTGTCTGTTCTGTGCGTTGAGCTGCTCGTGTGGGGAAA
TAGCGGCTCCCGGCGGTTCAGCGGATGTGGTCGCCCACGGCGGTGCATAGTGCCTGTCAGTAGTGAACTATATGGAGTATATCAAATTATAGATTACATT
TGTTTATGAAGGTATCTTATATTTTTACATAATAAACGATTGATCGTATTTGAAAGGGTATATATTATACAAAGTTCTCTACTTGAAAAATTTACATCAC
CCCACAATCTGATACCCCGTTGAAATGGATCCCACAATCTCAGACAGATCCCTGCAGCATTTTATATTCACACCATTGCCAAAAAAGGCACCAGACGCCA
TGGCGATGTACACCAAGATGACGTCCACGGGCTCGTCGCTGATCGTGAACCCGCGCACGATCTCCAAGGAGCTCGAGGGCAAGATCTCCGCGTCCATCGC
GGGCGTGATCGCCAAGCACGACGCCGCCAAGCTCACGACCAAGCTTGTGCGTCAGGCCGTCGAGAAGGACATCCACGTGAGCCTCACCAACCACAAGGAG
CTGCTCAAGCGCCTCATGCACCAGGAGTTCCGCAAGGTCAAGGCGGCGAAGGTACGCATACGCACATGCATATCTTGTATAATATACACGCATAAGCTAA
TCGCATGGAGCGCTGCCCACAGGTCGCCAAGCGAGTCGTCCCCGACGCCTGGAAGAGCAAGGCGCGCAGAGAAGCCATGGCCAAAGGTTGACGCTGCGCT
TTACTATCCACCGTACAGTGTGGCTGTGTATGTGCTAACTCACGTGTTTCCTCTATGCTGTGTCGTAACGTGTCGCTAGGGCTGTATCGCCTGTACACGA
TGCTGCGCGAGGACAAGGCGCTCTTCGCGCAGTGCGGTCTGCAGGCGATCCAGGCGCTGTACGAGCTGCAGGCGGTCGAGTCGGACGAGATCCAGCGGCT
CGCGACGCTCTACGTGCGGCAGCTGGGCGCACTCTGGCTCAAGAGCGAGCTCGTGCAGCAGCAGCTGCAGGCCGACTGGGCTGCCCCAGGGGCCGTTCCC
ACGCCGGCGCAGGTACGAACTTTGCACCATGTACCAGCATTTATTCATTTGGTGAAAACTAATGCTCATGTTTAATATTTTAAAATCCTTAGGTGATTGA
GACGCTCAAGTCAGTGTTTGTTGTGGAGCGACTGGGTATTTACCACAGCAAGCGCGTGGAGCTCTTGGAGTTTTTCGACTCGCACGCAGTGCCACTGTAC
ACCCCCGAGGTTGGTCGCTTTGGATCATCTCCAATGGTGTGGTCTATTCGCACATGTGCGAGCTTATGATTGTTTCTTATACTTTTTATTAGGACTACTT
TGGGTGGAACCCAGCGGTCGGACCGCCCGTCTCGGACGCAGAGGGCTCGGCGTACATGAAGATGGCGAATGCACTCGTGGGCTCGTACTTTGCGCACCTT
GTGAGCGCGCCGCTCGGTTGCTCCTTTGTGCAAGTGAGTGTTTTTCCCATAAAGGTCTTGTTGGCTGGTTCGTCAAGGAGATGACTGACAATGTTGATTT
TATTATTCTGGCTTCGTTACGCCAGTTGTTCCAGTTTCTCCCGTCGTTCTACCCGTTCAAGGCGCCCGAGCAGCTCTCCACCGCTGACTACAGAGACCAA
GTGCTGCTCGTGACGTCGATCGTCATGGTCGTGACCAAATTCGGGAGTCTGCGCTGCGAGCCGGTACGCTTTCTTTCCGTTGTTCGCTTGCGCGTGAAAC
AATGAGCAAACCTCATTCTTTTCACTATCGGAATCTGTTGAAATAGGAGCTCCTCCCGCACGAGTATTTTTTCCTTCGCCACCACCTCGTGTACCATCTC
GCGCAGCAAGATATTGTCCTCGTGAGCGAGACACTGCGGGTATTATGTTATATTTATTTAATGAGCGATTCAAAGATTAAGCGCGATGGTACGGTTATCT
AAGTGTGTTATTGCTTTATTTCTCGTAGGCGCTGAAGTGCTTTGACGGGTCTGAGAACCTCGTGCAAGTGCGTCGAGGGATGGCGTTTTTGCTGCTGACG
CAGCAGAAAGACGGCTCGTGGACCAACGCAGTGGAGAGCGATCCGGTGCGCACGTACTTTTCGACCGTGAACGCCATGTGGGCGCTCAGCGAAACCAAGC
CGACGGGCTTTGCGCCGTCCCTCCCCGAGATCACGCCACTGCTGGAGCTCCACATCAATGCAGACATTGGCGCCCACGTGAGTTTTGTTATTCCATTATC
AATTGGATACTTTATCAGCGACCGTATTGACGATTCCAATTCTTGTGTTATTCAAATCAAACAGCTCCAGGAAGCAGCAGCTCAAGCTCAGAAGAGCGCA
AGTCAGTCAAAGAACTCGTCGTCTGCCCAGAGCTCAGCAGACAGCTCCGGCACTGAAGTCACCAGCACTTCCGGTTCTGAGATCCCACTGGAGACGGGGG
CGGCAGAGGAGGACCTGCAGACGCAGGTGCTATTCCTGCAGGGCATGCTCGAGAAGGACGGCGGAAACGTCAAGAACGTGTCGGCGACGCTCGCGACCCA
CGTGGTGAACACGCTCACAGGCCTCGTGCTCACGGTCGAGATCCTCAAGACGACGGGCGTCGGCCGCGTGATTAACAAGCTGCGCAAGCATGCGTCGCCC
GACGTGGCCAAGAGCGCCACGCAACTCGTCGCCAAGTGGAAGAAGGATTTGTTAT