Description :
From Genome Similarity Track
Location :
Scaffold_390:390- 2999
Transcript NameFunction/comments
Sapdi_VS20SDRG_17448hypothetical protein

Sequence
614 bases(100 bases per row)
GTGTGCTTGAGCCAGCACACACCGCTGTTGATGGAGAAGCCGGCGCAGCCGTTGGTCGAGCTGCACGCCGCGCAACACTGGCTGAGCTGGTCTTGCGCAC
TGCCCCACACCCCAAGGTTCTTGATGTCGTTGCCGTAGTAGTCGAGGTCGCTCTTGGCGTTGGCGCACTGGCCGCCGCTGTTGGGCTGCGGCGCGGGCCC
CGGGTTCTGGCCGTTGCCTTGCAGCGGAACGCAGTTTTCTACGCACAGTATCGCAGCGTGAGCCATGGAGCCATAAAGGTCGTGGGACGCACTGTAGACT
TGCCACTCAGGCTGGTGTAGCGCAATCCAGTAAAAGCGCAGCATGCAGCCGTCGCCCGCGCAGCTCGAGTAGTCGACGGGGAGGTGCGCGGCCGGCTTGT
CGCCAAAGTTGGTCGCGCAGTCGTCGTTCTGAAACACGCGCTTGTTGTCGAGCCACACCTCGCAGGGGCCCTACCAATGAGTGCAGCTTGAGTATACATA
GAGTAGTGTCGTTGGGTACCGTGTGGCTCGGGATGAAGCCTTCGCCCGTGTCGGGGTTCTGCCACGTCATCTTGCCGTCCGATGGGATCGCCTTCTTGGC
GACGTTGGTGAGCG