Description :
From Genome Similarity Track
Location :
Scaffold_40:390- 2910
Transcript NameFunction/comments
Sapdi_VS20SDRG_11179hypothetical protein
Sapdi_VS20SDRG_11180hypothetical protein

Sequence
2520 bases(100 bases per row)
ACGCCGTCGTCGACCAAGTATGAAGTCGCGTCCAAGCTCTTTGAGGACGGCGTCTCGACGCTGTCGTTCCAAGACGCCCAGCGCAGCGACGTCAGCGCAC
AGCGCGTTCGCATTCAAGACGCTCGACGGAGCCTCTGCCACGACCAGATCGCTACACTGCGCGGCCGTCGCGACCGGCTCGCCGCTGCACTCGCCGCCAT
GGACGCGCGCATCGACGCCCGCGTGGCCAAGATCGCCCTTGTCGAGCAAGAGCTAACGCTGTCATAATACTGCTACTGCTGCTGTTGATGCTGGCAATTA
TCTTTGCGCCTCGTCGCTCGCGACCGCTGGAGAGAGCGTCGCGGCCACATCGGCACTCGCACTACAGAGCTGCCGGTACAGCTCTATGGCTGCCTCGGCG
AAGGCTGGCTGGGTGCATTGCTTTATCTTTTCGGTGGTCTTTTACTGGAGCGCTGTGATTGGTCAAAACTCGGGCAATATATCTCTCGGCGGCAGGATGA
GCGTGACGACGGACGAGCTCGCGCGGTACGCATGAGGATGGTGCAGGATGAGGATGCGATGCCTGGCGTAGGAAGCTGAGCGAGCTCCATGAGGAGGTCG
CGAGCGTCAAGGCGCAGATCTTCGAGGCGATCCGGACCTTCTACGCTGGCGCGCAGACGACGTCCTCGAGCATGTCCCTCGACGAGGCCATCGAGTTTGC
CGGGAGCTGGTCGCGCAAGGTCGACCTCCGTAGCAACCTGGCAGACCTCCCGGCGAGTGAGATCCAGCTGCGCATGGCGCGTCTCGAGACGGTCTTGTCC
GAGACAGTTGCGCAGTTGCAGCACGACGATGACGCGTCGAGTCGCGGGACGTTGCACCAGTCTGTTCTCGCGCACGAGCGGCTGAGCGTCCAGATCCAGC
AGTCGCAGAGCACGCTCTCGCTACTGCAGCTTCTCTCCGACTTGGACACGGGTCTGCAGAGCTTCGACCTGGCGATGGACGTGCCCGACCTCACACGCGC
CGCGACCGACCTCGCGGCCATTCAGACGTGTCTGACCAAGGTCGACTCGCAGCACCCCAAGGCGTCCATGGAGTACCGTATCGTGCAGATCATGCAGATG
CAGTACGAGGCGCGCCTGAACCAGCTGCAGTGCTACCTCGCCGACTCGCTCTCAGGCCTCTGGAAGATTTCGCCGCGTTCGATGAGCATCACGCCGACGT
CGATGCCCGTGTACGCGACCTTGCAGCGCACGGGCCGCTTAGTGACACACCTCGAGCAGCTCGCGGCCGACCTGTACGAGCACATTTTTGCGCCGCTCGT
TGCGGACGCGTCGCTCGTCCCGACCGTGCGCCAAACGATCGTCACGTTGACGCCCAAGACGGCAGCCTCGTATCCCTTCCTCTGTACCTGGCGTGGGATC
CTACGTCTGTGCATAGGACGGGCATTCCCCGCGTCCAGCACCTCTGTGCCCACGTTACGACGCTGCTCAAGTTTCTTGCGCCGTTTCTTCCGCCGCTCGA
CGAAGGCGAGAGCGTCCTCACGAAGCTCATGGCCGTTCTGTGGTCGTCGGCGCTCGAAGCAGCGTTTGTATCGCTGCTGCAGTCGACGCTGCCGTCGGAC
GCGGCCCAGTTGCGGGACTTTAAGCAGCATTTGACGCCTGTGGTGCGTCCTCGAGTGACCGTAGGCGACATGTTGACCACGTTTGTGCTATGGCAGATGC
ACAGCTTTGAAGCCTCGCTCGTGGCCCTCCGACTTGCCCTTCCGTCGTCGCTCGTCTCGTTTGGCCAGCACTTGGACGTGTACAAACTTGGCTGAAACGG
AGGATATATATGTACGTGCGACGTAGGCAATTTGCCGAGCACAAGCGCGCCACGCTGCTGCAGGAAGCCCGTCAACGCATGCAGCACGACTACCTCAACT
CGGTGCTCGTGCCGAGCTACCCGGCCGTTCTTGTCCCGACCAACCACAAGAAGAAGGTCCAAGTGTCACCCGTGGCGGCGGCGGACGACGACGACGACCG
ATCGACGCCGATGCGCGTCTCGGTCTGCGCGCAGTGGCTTCTCGCGCAGGTCGTCCAGCTCTTGGCCGAGACGAGCGAGTGCGATCCAAACGTGGCGGCG
CCGCTTTTGTTTCAAACCGCTCGGGATCTCTTCAGTCTCTTCTCGGCGCTCATGCCAACGCTGTACAAGGAAGAGCTGCGCTTCGACCCGCGCCTCGTCT
TGCTGCTGCACAACGACGCCATGTACTTTACTCGGCACATGCTCACGCTTTGCGACAAGTCGCGGTCTCTTGCTGTCCGTTGCCATCTCGATATCTGATA
TATTGATACTAGATTGCCGGCGCCGCTGCACGACAGCGCGACGATGATCGACTTGATCCCAGACTTGCGCGATCTCGGCGAGACCAAGCTCGTGGCCTTT
GGGAAAGCTCAAGCGACGCAGCTGCAGGACGCGCTGCGCACTGCGTTCGTGGTCGGCAATTGTCTTGACTCGGTGGCTTCTCATGCACGATACCGTTAGC
CGTATGCGACGCTGGACGAC