Description :
From Genome Similarity Track
Location :
Scaffold_450:390- 2676
Sequence
2286 bases(100 bases per row)
GAATTTGAGGACGTCTTCCCCGACGAGGTACCGTGTCGCCTCCCAGTCGACAAGGGCGTTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTATTGTG
TAACGCGGCAATGGCCGCTTCCTCGCGACCAAGTCGATGCCATCGACGCATTCTTCGCGGCCCGCAAGGCGGCGGGTCACGTCCGCGAAAGCATTTCCCC
TCACAGCAGCCCGACCTTCTGTGTGAACAAGCCCGGTGGGAAATGGCGTATTGTGCACGCCTTAAACAAATTGAACGCAGCCACGATTCCGGCTCAGACG
CCGGTTCCTCGCAAGGACGTTATCATCGACAGCATGGGTCGATCCACCATTTTCTCCACCATCGACCTTCGCGATGGCTTTTACCAGATCTTGATGCGTC
TATGCGACGTCCCAAAAACGGCGGTTTCTACGCCGAGAGGCATGTTATGGGAGTGGCTGGTCATACCACAAGGTCTGTCCAACGCCCCGGCGACGTTCAA
TCGTATGGTTACCGTGAAGTTCCGCGCGTTTCGCGACTTCGCACCGTCGTACTTCGACGACATTTATGTTCACAGTTGCGCCTCCTCCACGCAATCTGAT
CTTGACGTTCACCGCGGCGACCTCCGCAGGGTGCTTGAAGTCCTCCGTGCCAACGGACTCTATGCCAACCTCGCCAAATGTATGTTTGGCATAGACGAAA
TCCCGGTCCTGGGAGATTTAGTGGGGGTGAACGGATGTCGGGCTGATCCCGAAAAGATCAAGACCATTTCGGAGTGGCCTATCCCCTCCTCAAGGATCTT
CGTCGCTGGCTGGGCCTTGCGACGTACCTGCACAAATACTCGCAAAACTTTGCGGACATCGCCCAGCCGTTGTTTCGGCTTCTCCTCAAGGACGCCCCTT
GGGTTTGGGACTCCGCTTGTCAGGAGGCTTTCGACGGCCTCAAAATCAACCTTCAACGCGCCCCGATCTTGGCGCTCCTGGACTTTGACAAACCTTTCTC
CGTCGTTTGTGACGCTTCGCAATTCGAAATTGGCTGCTGCCTAATGCAGCTCGACGCCTCCGGTCACCCTCGCCCGGTCTCCTACCAAAGCCGCTAACTT
CACGCGGCTGAGCGGGCGTACCCAGTCCACGATTTGATATTTCTCTCCATGAAGTACGCCCTGACCAAGTTCCGCATCTACCTTCTCGGCGGTAAACCCT
TCGTGATCTACACCGATCATGTGTCCTTACGCACAGCGATGAACACGCCCCACCTTTCACAGCGCATGGCACGCTGGATTTCGTTCTTCTCCGAATTCAC
ATTTTCGGTACAGTACAAGCCCGGGAAGGACAACATCCTGGCCGACGCCCTTTCTCGGCGTCCTGATCTCGAACTGACCACGATCGGTCTTTTAACGTCG
GGTCTTCACGATCGAATTCGTGCAGCATACCCCTTTGACGCTGACTGCTCGTCGCGCCTGGCGGCGCTCACCGACCCCGTTTCCACCAAACCCCGCTGTG
CTTCGTCGGCCTTACACCGCTTCGCCCTCGCCGATGGGCTTTTGCTGCTTCAACCCACAGCGGACTCACCGCCGCGCATTGTTGTGCCCGGTAACGCGCA
ACTGCGCCTCACTCTCCTTCGATCCTACCATGACTCCCCCAGCGGCGGCCATTTCGGCCGCGACAAAATGCACGCGGTCCTGGCGCGTTCATACTGGTGG
CCCCGCGTGTATAAATTCGTTGTGCGCTACGTCGCTCATTGCGACGCTTGCCAGCGCACTAAAATCACCGCCTCCTCTCGAGCTCCGCTCCAACCTCTGC
CTATTCCCGACGAACTTCGGTCGTCCGTCAGCATGGATTTCATGTTTGGCCTGCCCCGTGACGCCCGTGGCAACACCGGCATTATGGTTTGTGTCGGCCG
AGCGTCGAAGTACGTTATTGTCGTCCCCGTCCGGGATACGCTGTGCGGTGCGGATGCCGCTCGCCTCTTTTTCGATCACGTTTTCTGTCGTTTCGGTCTG
CCCTGCTCCATCGTCTCGGACCGTGACCCGCGGTTCACGGCGAAGTTTTGGTATTCCTCGCTCGATATGTCAACTTCGGATCACCCCGAGTTCGACGGCC
AAACGGAACGCGCCAACCGCGTCCTCGAAGATATCCTCCGGAGCTACTCCGTTTCTACCGGTTCCTCGTGGGCTGTCGCGCTACAGCACGTGGTTTTCGC
TTACAACGCCTCGGTTCAGGCGTCCACTGGCTTTTCGCCGCATTATGCGGTCCATCTCCAACACCCCCGCCTCCCTCCTATGCTCG