Description :
From Genome Similarity Track
Location :
Scaffold_1220:390- 2347
Transcript NameFunction/comments
Phyke_g11667hypothetical protein PHYSODRAFT_340298

Sequence
1957 bases(100 bases per row)
ttgtcgaagatgcgAGAATTCCAAAGGGTCAACGATCCCAAGCGGTTCACCTGCCACCAACGTTCGGGAAGTCAGATAATCCGCAGCTTGATTGAAGTCA
CGTTTCACATGGACCAACTTCACCGACCCGAACTTCTGTCTAATCGAATTAAACTCACtgaggagaagctgcagcttcggctGATTACAATTGATCAACC
CTTGGGCTTGCTGGATCGCAATTCTTGAATCACCTACCACAACCAGGTCATAGATTCCTTGCTCAAGCGCCATCGTGATTCCTCTGATCATTCCATGGTA
TTCCGCGTCATTTACTGTGATATCTTCTAGAATGAAGCCGCGAGCACTCACTACATTCCATTCCGGGAGTTTCCACAAGATACACCCGCAACTGCCACGC
CTATCAGAGGTTTTCGCTGCTCCGTCAAAGCTGAGGAGGTAGCTCGAAAAATTATTCTCAAGCATCTCCAAGCTTATCGGTGGGGCCGGTACTACTCGCC
CTTTGTTTAGAATTAGAGATTCTGCAATCTTGTCGAGGTGTTCACGAGAAGTAATACCTGCTCCTAGAATAGCAGCAAGTCCATCCTCATCTTTCTCAAC
ACGACGAACTTCCAAATCCCAGGGCGACAAGGTCGCTGCCCACCTCAGGCATCTTCCTTCTAGTGACTTCGATACGAAAATCCAACGCAGGACCGAATAA
CGCGTATACACCTTGAGGTAACAACCGGAGATCAGCGTATAAAACACTCTCAAGACTCGTAGCAGTGCTACTACCTCTTTTTCGGCCGGATGATACCTCA
ATTCTGAGTCGTTCAGCGTCTTGCCTGTGAACCGAACCGGGAGGATTACCCCGTCATACTCCTGTCCAAGGACAGCACAAGTTGCCCAAGGGTTGGCATG
GAGGATCACCACGAAATCTCTTCCACGATCGGGATGGCGTAGCAGCGGTGTCGAGActatcttcttcttcaagattTCAAACGCTTCTTTGGCACGCCCC
AAGTCTCGGCCTTCTCTAATCTGCTCATCCGTCAACTCATAGAGTACAGAAGCGATAACAGGGAGGTCTTCCATGAACTTGTTATAGTAGCTGAGACTCC
CTAGAAAAGACTGGACTTCTTTGAGTGTAGACGGGAACGGCAGATCGGCCACGCCTTTGGCAATCTTAGGTATCACGCGCAATCCTTCAGCGCTGATCTC
GTGTGACAGATACGGGATGGACAGCTTCCCAAACTCACTTTTGGGTAGACTCACCGAGATCCCCCAATACCGAAGGCTGAATAGCAGCGAATTCAGGTCT
GAACAAAGTTTATCCCAAGTCGGCGCTCCATGGGCGATGTCGTCGATATAAGAGCTTCGCCCCAGGACAGGCCCCATCCGGAGAGAGGCTGAAATATCAC
GGTGGAATACAGTCATTCCACTCGTTAATGCTGGGATCCCTTCCTCAGCATCAGTAGCAGGATACTCTCCTACCTTGATGTCCAAGAATTCCAACACATC
CGGATCTACtttggcttcttcatcagGCGGCAGCCGTACGAAACCCCAGAGGCAATTATCCAGCATCTACTGATAAATCAAAGGAGCATTCTTCAGACCA
AATGGCATGCACATCCACTGGAAGTGCCCAAAGGGGCTTATGAACGCTGAGATGAGCTTTGCTCGTGAAGTCATCGGAACAGCCCAAAACCCGCTAGCCA
TGTCCAGGCTCATAAACCACATTGCTTCTTCGAAGCCGATCAGCAGATCATCGATTAGAGGTAGCGGATAGTAGGACAGCTTAATCAACTGATTCACCAT
CCGATAATCGATACATAACCTGATGTCcttgctgttcttcttcaaaaTGATCACAATGAGCGAGGCCCATTCGGAATCCGAAAATTCAATCAGACCTGTT
TCcaggagcttcttgatcaacTCATACACCTTCAAGAGATGACGCGGGGTTATTTGA