Description :
From Genome Similarity Track
Location :
Scaffold_76:390- 1740
Sequence
1350 bases(100 bases per row)
TCAAGCTCGGCTTGAATCTTCTCGAACCTCTGTTCGGAACGTGACTCCATTGCCGAACGCTGGGCAAGACCATCGAAGAGCAAGTCGATCTTCGACTCCT
GCTCCTTCAACCGGTCTTCGAGGCTTTCACACCGGTCTTCGAGTACCGCATTGCGAACTTCAAGAGCCTCGATCTGAGCGCGATGAGCACTCTTCCACTT
CCAGAGTCGCTCAATCGTTTTCGCGTTCAGCCCCACCTCCTCTGATCGATCATCAAAGAGAGCGTCGTTGGATCGTTGAGTCGATAGTCGATCACGAGGA
TCGATCGACTCGTCGTCAGGGAAAGAAGCAGTTGAACCGTCAACGCTTCTACAGAGTACGGTGGCTTGGCTATCCGCCGGACTCGGACACGTGGGAACCT
CGAGAGACTCTTCAGTCTGATGTTCCCGACGTGGTTCACAGCTACGAACAAAGCTTGTAGTGCTCTCGCGAGCACTAGAACGACGAGAGCCAAGCTCTTT
GTGGTCGTTCTCGAGCGTGCCTCCTAGGTTCCCTAGCAAACGCTCGACAAGATGTTCATTCTCGAGTCGGACAAACGTCTTCCACGACTCGAGCTTCGCT
GTGGTGGATTGGCCAGGATCGTCACTGCCGGACATCTTGCGCCAGCGGAAGAACAACTCCTTGTAGAACCGACGTCCTCCACGTTTCGCGCGAATAGCGG
AGATGTCGTACAAACCGGGAGCCGTCCGCTGCCGCTTCGGCTCGGGCTGTTCTTCGCGCTTCACTTGGTTGCTTGATCGCTTCATGGTCAATTGAAAAGT
GAGAGCGGATACCTCTTCCAAAAGAAGTAAAGTCCATGATGGAACTTTAAGGGAGGGATGATGTAATGGGCTAAGCTGCCATTACATGCAAAGTGGCTCT
TTGTGTGTGTCACACGCCACCTTGTGGAAGTGCATTGTGGGTGCGAAGATATTGGGTGAAACACATAAAAGTGATCCCACATGCACAGTTGACGTCATCG
TCTGATGTCAGAGCAATCTGTGTCTGAGCTGAGTGTTGATCGCTCGCAATCATTGAGATTCGGCGTGATTATGCACGAGAGTACTCTAGACATGTGAATG
ATGGTTCCTACTTGGGGAAACCACACTGGTGACGAGATCAACGTGTCTCTACCATCTGAAGTGAGTGGCTTCCGCCAATCACTTTGCAGGGAATCTCCGC
GGTACTTCAAGTTCAAGTTTCCAGCAGATCCCCTGGGTTCAACCTTAGTGTACCCAAGGTTTTATATATCAGATTCATAGGTTTTATTTCTGCATGTTTA
GGTTTTATAAGTAAAACCTCTAGGAGCTCTAGTGGTGTTTTATATGTAGT