Description :
From Genome Similarity Track
Location :
Scaffold_498:390- 1699
Transcript NameFunction/comments
Phypl_g8901serine protease family S10, putative

Sequence
1309 bases(100 bases per row)
CGAGGGCTCCTACGTCTGTGGTGTCGCCAACAGCTCAGCGGGGCATATCAAGTTGGCGAACAGGGTGGACGACTACTATTTCTACTGGTTCTACGAGTCT
CGTGGCAGTCCCGAGACGGACCCGCTGGTGCTTTGGCTCACGGGAGGCCCCGGTTCATCCAGTATGTTCGCTCTACTGACCGAGAACGGACCGTGCACGA
TCCAGTCTGACTTGACCACCAAGTTCAATCCGTACGCGTGGaacagcaacgccaacgtGATCTGGCTCGACCAGCCGACGGGTGTGGGCTACTCGTTCGG
CTCCCCCGCTGATAAAGACTACAACGAAACAAACGTGGGAGAAAACATCTACTGGTTCCTGCGGGGGTTCTTGGAGCAGCACCCGCAGTATCAAGGCCGC
GAGTACTTCGTGACGGGCGAGAGTTATGGCGGCCACTAtgttccagctgcagcacactACCTTTGGGAGGTGAACAAGCAGAGCAAGTCGGACGGTGAAG
GCCCGCTCCTCCTCAACTTGAAGGGCTTAGCGATCGGCAATGGGCTGACGAACCCGGTGATTCAGTACGCGTACTACCAAGACATGAACCACAACCGATA
CAACCTCACGCTACTCACTGACgctgaagagcagcagatgaaggccgacagcgtcgagtGCATTCGCTTGACCGAAGAGTGTCAAGCGGCACCTCGCAAC
GGGACCATCTGCAAGGTAGCACAAGGTTGTTGGTCAGACAAGCTGATTGCCCCATTCAGCAAGGCGAACCGCGACAACTATGACATCCGCCAACCATGCG
ACAACAGCGACCCCACCGCAGCTTGCGGCGACCACCCTCTCATCGCGGAGTACTTGGATTCAGCCGCGGTGCGCAAGTACTTGAATGTTGATGAGCGCGC
CACATCCTGGCATGAAGACAGTGATGACGTTGAGAGCACGTTCACGGACGATGGAGACTGGTCCATGCCATTCCACCAATTCGTTGCAGATatgctggac
gacggcctCCGCGTGCTCATTTACGCTGGAGATGCCGACCTCATGTGCAACTGGGTCGGCAATCGAGCGTGGACGTTGGCGCTCGACTGGAAGGGCAAGA
GCGGCTACAACGCTGCGGAAGAGCGGACTTTCGTCGCTCACGACCCGTTGCTGCCCGACGGAGGGAGCGACATCGATGCAGGTGTGGTGCGTTCATTTGA
GAACTTTGCTTTTGTCCGCGTGTACGATGCTGGCCACATGGTGCCAATGAATCAACCCGCAGTCTCGTTAGACCTCATCAACAGGTTCCTCACCAACAAG
CAGCTCTAG