Description :
From Genome Similarity Track
Location :
Scaffold_1850:39- 1667
Sequence
1628 bases(100 bases per row)
GGATAAGCTATATTTCGCGATAACATAACCTAAAAAGAGATCGATCCGAATATGTAGCTTGGTATTATCCTTGCATGACTTGGGCAGCGACGGATGTGGT
CAATGGCGACAATCTAGAAAGGGTAGGTTGCTTTTAGATTGCCGAACGACTTTCCGTGTATCGTCGGACACCCTTTCCCTGTCTCGCAGTCCTTACATTC
GCCCACATAACGTTGTACCCTGAGATACAACCCTCTCCAGTGGAATCGAGATCTGATCCGCTGGTAGGTCATGCCGCTTCCCTGGTGACCTCCCTCTAGA
CTGGAGTGGTAATGGTGCAAGAAGGCTTGCTGTAATATATCAGGTTTTACTAGACGCACCAACCCGTCATGATCCTTTGGATTCTTTTTCGCGAATGGAC
AGAAGAATAGCAGATCACTCTCATCAATCTCATAATCTGGTGCGATTTTGGCACACGTATTCACTTATACTGAACCCAGGTTAGATACATCGCCCACTAG
ATGCTACTTCAAGTTGACCTTCGAATGTTCTTTATCTTGGGCTTGACAAATTTGCTCGCTTCTGATCCTCCGCACCAATTCTTCCTGTAAGNNNNNNNNN
NNCGGATGACGTCTCCTCTACACCGGCCTTGTAATTGCAGTAATATTACCGACTCGATATGCGTATTTTGTCATCATCAAATCGTCCAAATGATTCAGAG
TAGCCATATCTTGGCGATCTTCGTCTGTTGTAATAACAGTCCCTTGACCCTTTTGGAATGCAGCACTGGATAGCCGATCTGCACTTTGATTTCAATCTTT
CATCATGTGTCACTCATGGATCGGCCAAGATCGCAATTTCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAC
CTGTCGAATCATTAATTTGGAGCCGCCGTATAGAATGGCCCGCCCTCGGTCCAGGTCAGCAAGCAAATCGAAACATAACAGCAAGCCATTATACTTAACT
TCATTTACCGCCAGATCGGAAGTATACCTGGATTTCGACGACAAGATCATCCGTTCTGAGAGATTCCATATTACTGCGCTGTATGCACCTCCTTTTTTCT
TGATCCTTGCCGATCCATCGAAAAATTGGCCCCTGCTCCCTTTTACTGTCAGAAAAGGCAGAAGGGGACATTTCCAACATCTCTTTAATTCCTCGCGCGG
GGTTATTCATGCTGCCAATGCTCCCAATTCTCATCAGCTCTCGTTTTGCACTTCGTCATATCCATATTCCAGTTCGATAACTAAGCATTCCAGCGTCCTA
GGCTTCCGTTGATACCTCGATATCGCATCAACCATGGAAATGTTGAGCGTCGTGTCAGAACCATGATCTCTATTAAGACCAACATAGTATAACACACATT
CATTATATGAAGCAATTCCAACACTAACTTCTCAACCTTCCAATAGTTGAGTTTGTTCGCCTTCAACGTTCGACTTGTGAAAGTAANNNNNNNNNNACAC
GAAATCCTACTCTTGGATCAGGGCTGCTGAGACTACCCACTTGCAGGCATAGACCACAATCACTGGAGGACGATCTGAGTCAAAATGTCTTAGAGTCGGA
GGTTTGGCGATCGTCGCTGTTGAGGGTT