Description :
From Genome Similarity Track
Location :
Scaffold_509:39- 1572
Sequence
1533 bases(100 bases per row)
AGTTCCTTGGCTTAGCGGTGTATTTGCACAAGTATTCGCACAATTACGCCGAGGTGATGGTTCATCTCTATCATTTGTTAAAAAAGAACGAGAAGTGGGT
ATAGAGTGCCGACTGTCAGCGCTCCTTCGAAGGCATCAAGCAAAGCTTGATACGGTCGCCAGTATTGGCAATTTCAGACCAAGACATGTCATTCATGTGA
GATGTGATGCCAGCAATTTCACAATCGGCTGTGCATTAATACAGTACGATGCAGACGATGCGGAACGCGTCTTCTGCCATTAGTCTCGTCGGCTGCAACA
ATCTGAACGGTTAATCACCCCATCTATGACAAGGAACTTCTTGCCATGAAGTACGCGTAGGTAAAGTTCAGGGTCTACCTGTTAGGTGATAGAACCTTTA
TCGTCTATACGGATCATGCGTCTTTACACACGGCCGTAAATAGTCCACATCTCTTGCAACGAATGGCAAGGTGGTTGTCATTCTTCACGGGGTATAATTG
CTCCGTAGAGTATAAGCCAGGTCGACTTAAATTCGTCGCTGAAGCAATTTCTCTTCGGTCTGATTTCGAACCGGCTGCGCAACCCGACACTGGCATAACC
ATTGTTGCAGCTTTGACCTCAATTGTCCCGTCGTCAACCTTACTAGAAGACATACAAAAGGCGTATGATTCGGAATTGTGAGTCTGATGAATCATCTCTC
GCAATATTCTCGGGATAATTTAAAACAGCTGTCGGCAGTTTATCGATCCTCAATGGATAGATATACAGATTACAACGGTTTACTGAAATATTGAGCTGTT
TCCGGCGACACACCTCGTGTCGACGTACCAGATAATGGTGATCTGCGATTGCGTATCATGTATGAGTACCACGACGCACCTGTTGGTGGACATCGTGGTC
TTGAGAAAACATATACCACAGTGAGCCGCAACTTTTACTGGTCCCGCCAGTATCAGTTCGTGCGCAAGTACGTTCAGGCCTGTGAGGTCTGTCAACGGGT
GAAATCTAGTCCTTCCCTTCGAGCCCTGTTGCAGCCACTTCCCGTCCCGGCCAAGTGCTGGGAATCCGTCTCAATGGACTTTATCTTTGGATTCCCCGCA
GACGCCCACAAGAGTACTGGTATTCTTGTGTTCGTTCACATGTTCAGCAAGATGTTACATCTGGTTGCTGTACCCGAATCAATCAATGCATCGACTTGTG
CCCGTGTCTTTATCGACACGGTCTTTCGCCTTCATGGGTTGCCTCGTGAACTCGTGTCCGATCGGGACCCGCGGTTCACAGCTGAGTTCTGGCGTTCGTG
TTCAAAACACTCGGAACGCGCTTAAAGATGTCCGCGTCTGACCATCCTGAAACAGATGGTCAGACCGAACGCGCCAATCGTGTCATCGAGGAGGTCCTTC
GAGGATACGTCCATTCCTTTACGAATTGGAGCGAATTCCTGCCGGTGGTGGAGTTTACAATCAACAACTCAGTCCATGCGTCGACGACGCACACGCCGTT
CTTCGTGAATGGCTTACGCCATTCGCGTCTTCC