Description :
From Genome Similarity Track
Location :
Scaffold_5329:39- 1404
Sequence
1365 bases(100 bases per row)
CGCGAGTCGTGGTGCTCGTAGAGGATCTGGGTCTTCAAGTCCTCGCCGTGAGGGACGACGATGCGAGGTGGGTCTCCTGAAGAGGCCAAGTACCACAGCA
AGACATCGTTGATCCGATGACGATGGAGGCTGGACGAGAGTCGAGATGACAGCGGAGGGCGCTTCGTTGAAGACCAAGCCAAGTGCGCCAAGAGTGACTT
GCAGTCATCGCCGCGCGAGTATGCAGCGCGGATCTCGTTGCTCAGCAACGAGCCGACTCGAAACACCTTGGACGCGGCGTCCAGTTCCACTTCTTGAAGA
GCAAGCAGGTGAGATTGCTCGTAGTCGGGGTGACGCGACAGTGCGTCGGCGAGTACGTTCAACTTGGCGGGCTTGTACTCGACAACGAAGTTGTACTCCG
CAAAGAAGGTGTGCCAATTCATCATGCGTTGCGACAGATGGGGCGAGTTCGTCACCGTGCGCAGCGATGCGCGATCTGTGTAGATCCCGAAGGGCTAGTT
GCCAAATAAGTGAACGCGGAACTTCACAAGCGCGTACTTTATGGCAAGGAACTCCTTGTCATGCACCGGGTAGCTCTTATCAGCTGGCCGGAGCTGACGA
CTCTGATACGATATGGCGCGCTCTCGTTCATTTTGATGCTGCATCAGAGCGCAGCCGATCGTGAAGCCACTTGCGTCGCACACGACGTGGTGTGGCAGGT
CGTATCTCGGAAGGCCAAGAATCGGGGCGTCGAGCATACGCTGCTTGACAGAGTCGAACACGAGCTTGTGCTCGGGTGACCATCTCCATGCCGCATCTTT
CTTCAGCAGTGCGGCAAGAGAACAAATCAGCTCTGCGTATCCTTCGTGGTACTTGTGCATGCAGTTGGAGAGACCCAACCACTTGCGAAGACCCTTCTGA
CTCGCAAGAGCCGGCCAGTCAGAGATGTCTCTCAGCTTCTCGGGGTCAGCTCAAACGTCATTGCGTCCGACAAAACAGCCGAGAACTGGGATCTCGTCAG
CGCCAAAGATGCACTTCTTGAGGTTGGCATACAGCTCGTACTGGCGCATGATCGTCAAGACTTGACTAAGGTGATCGCGATGCATCTCAACAGCAGACTT
GTCGCCTTCGGCCTTGCTGTGGACAGAAATGTAGTCGAAGTAGCTCGACGCGAACGCTCTGCACGGGCACATCACATCAGCCCGGCAACGATGCGATTGA
ACGTTGCATGAGCGTTCTAGAGCCCCTGGGGCATCACGAGCCACTCCCGCAGCATACCACTGGGAGTGCTGACAGCAGTCAGCGGGATGTCCTTCTCGCG
GTTCAGGACCTGATAGAACCCGTCCATCATATCAAGGGTGCTGAAGATGGCTTGCTTGATTATGA