Description :
From Genome Similarity Track
Location :
Scaffold_2552:39- 1196
Transcript NameFunction/comments
Phymu_g14187hypothetical protein PHYSODRAFT_342798

Sequence
1157 bases(100 bases per row)
CCGACTCCAAGAAGCGTCATGCTTCAAAGTCTCCTTGTCAAGCCTCGACAAGGAGCGAGGACTTCAGAGACATCTTCGGtcctgacgacgacgaagaggg
GCAAGTCAACGAGCCCCAAGAGATCACCAACGAtctcgacgagcagcaagagctctaTCAAGCTGCCCAGCAGCCATTGCGCGCCGCGCCCGCGGCCGCA
GGTGGGTCCCATCAGCACGATGCCCACCAGCGAGGCTACTACCCGCCCGAACAAGGCtcgggagctgctgcctaccttgagcagctcaaggaccCGCGTC
CTCTCATAGGAGGCCATACTTCCAAAGGCGCCTATGAGCGGGCCTTGGTTCAAAAAGAACCTCTCTTCCAAGGCAACCTGTCTATTGCCAGGTGCGTGCT
TCTAGCACAGCACCGAATTCCTCTCAAGGAATTCACCACGCTTCGCAAGAAGCCCGAGACCAAAGGGGGTCTCAAGCCCACGTGGGGTTATCCGTGGGTT
CTCCCTGAGAACACCACTTCGTGGCTTGACGCCGAAGACCTCTTTTGGCAATGGGTCCGGTTGAAAGCCCATTCAACCCAGGAGTACAACGAACTCCGCG
ACGAAGATCAGCTGGAGCacatcctccagctccggGACCTTCGTGTCCAGTTTGTCCACCTTGTGGGCAAACGTCAGCTCCATCATCAGATGGAGAGACT
GAGAACCGAGTCTCAGTCCAGCGCTCACAGTGAGCGCGGGTATGGAACACATACACCTGTGTTCCAACCCCGTTCGACGGCTAAGAAGCCGCGAACTACT
TACGAGGCTGCCGCCGCGCCTCTTCCCAGTACGCGACAGCCTTCGGGCAGTCAACTTGGAGCCGCTCAATCGGCTCCCAGGTACTCTGCGACGCAGGATA
CCCGCGCCACTTCACtcggagctggcgcttccCACCGCGTCGCCGCTCCTGGAGAACCCGCTCCACATGGTAGTGGCGTTCTCCGTTCCGGTCAAGCAAG
GCCGGAGGGGGCCTCGCTCGACTACTCTTTCGAGCCGTCCCCGACGTTGGGGACTCCGAGGCCTTCGACTGGGCCTCATGACCAGCTTGTTGCTCTGCAA
CAGGAGGAGATCCGTCTCCTCCGAAGGCGTATCCTTGCGCTGGAGATTGCCCTTGGT