Description :
From Genome Similarity Track
Location :
Scaffold_1480:3898- 5112
Transcript NameFunction/comments
Phyag_g10750hypothetical protein PHYSODRAFT_314779
Phyag_g10751conserved hypothetical protein

Sequence
1214 bases(100 bases per row)
TCCGCCGATGGAGAAAGCAAAGACGATAGTTTCAATGAGCCCATGCAGGCTACATCCGACAATGACCTGCTCCAGTATAACGGTTGTTGGCAGCCAGATA
TAGGGCTGCAGTTCATTTCGCCTTGAAACCCTCCAGGAAAATAGTGCAAAAGCACTATCTTCGTTTTAGTGACGACAGATTTGTCCAGCTTTTAAGCCAC
GGATGGGAGGAAGCGAAAGCAAACTCAGTGCGCAGGCTCAAGTacagcgagaagagcagTATGTCCTTCAAATGAAAAATCCAGCAGTggttgcagcgat
ggaggcgCTCGAAAGTATGATCTGATTGCGTTAATAAGGCCCCGTTTGGTTCCACCAAAATATTGCAATATTCGGGTCTCGATTGTAATTTTGACGGTAA
GTGTATTTTGGGCGAGATTGCCGTTCCAACACACACCGCATTCGCATTATTTGAAAATCATAGATGGAGATTGTAATTTTTGGAAAAAAAGTTGGATCCA
AACACACCCACTAATCGTAATATTTCTCACAAATGGCATTTCGAAATATTCTACTCTGAGTAGAATCGNACCTGCAAGACCCAATGCCAGCCCAAGCATC
TTCTATGGCTGTCCGTGCTTCGTGGGACGTGGACATGGATAACTTCCTTATTGAGGCTATGACCGACCAAGTCAAAGCCGGAAAACGTGCTGAATCTGGA
TTCAAGAAAGAGGCATGGGTGGCTGTACATGAAGCCATCAACGAGCGATTCAACAAAAGTCTGTCAATCCAGCAAATCAAGACACGAGTTCAGACGGTAT
GAGCCACATTTGCGGCGAAAAGAATGGTTGTATGAGTATACTAATGACTTTATGAAATGTGCAGTTGAAGACCAAGTACACTACAATatcggcgatgctg
caggCTTCGGGCTTCGGATGGGATGCCAACCACAacgtcgtgttggtgcacgacgacgtgtgGCAACAGTATATTAAGGCAAGCACAATATCGAATTGAC
ACTATTGATCATGGCTGACTCTTTTTTTTTGTGATTTGCATTTTCGTTGTGTTAGGAGCATCCTAAGGCAGTCGACTNAGCCCGCATGAAGGCGCTAACG
CCATCACAAAAGGCCgtgaaagtgctgcagacCGTGTATGCTGAGCGCTTTTCGGCCTATGAAATGGCGCAAGCATTTGATGTGACGCTAGACGAAAACA
AAGCGAGACTCTTT