Description :
From Genome Similarity Track
Location :
Scaffold_158:38978- 42463
Transcript NameFunction/comments
Physo_143916hypothetical protein

Sequence
3485 bases(100 bases per row)
TGGGTTTGCCACCCAGTCCAGACACCTTGATCTGTTTGTGTCGGTTGAGCTTGATCTTGAGTCTACGCGCAAGATCCAAACTGATCATATTCACCGACGC
TCCAGTGTCCAACAGAATCTCCAGTCGCAAATCGTTCACTGCACCATGTACCGTAGCCACCTCATGCGAGTCCTTATCCGGTTCGTGATCAACCCACCAT
CCATACCGCTCACCGGGTTCCAGCCGAAATTCGGTCTGCCCGTCCGGTCCTCGCGATCCAGAATGGTTCCGTACAGAATGGTCGTCAACTTGATCAGACT
GAATCGGGTCGTCATTGCTCAGGGAAATCATGCATTGTTGGTGGTTATCTTGGTCGTTGGTCCTCAGCTCCGGTCCGACATAGGCTAGCACACACAATTC
AGGGGGCTTACGCCCGGCGCGTACTGGGTCCCCACCCAGCGGGCTTAGTGGTTTAACTGCCCACCTGCATCTGCCTTGTCATCCAGCAGCTGATCCAGTA
TGTTCTTCGGTATGTCCTTCAGGGCTCCTTCTTGTGCCAGCTTCTTCAGTTCTTCCACGGTCTTCGCAAGTCCACACAGTCCGTCATGGAACCGACCACA
GATTCTGCACGGGATGATCCTGCACACCCGCATCGGGTGTCCTCGACGATGACAACGGTCACACACGATGTCCATCCAGCAATTCTCCTGTCGATGTCCA
GGCCTTTCACACTTCTCGCAGAACTCGTGCCAGTCCGAATTACTTCCTCTTGGCGACTGCGGTGCGGAGGACGGACCGAATCTCGACGCCCCTGGCTGCC
GCACCGGCGGCGGCGGCTTCCATCCTGAACCCGTCATCACACGGAACACCGCATTGCGCAGAACGTCTTCATTCAGTACCGCCAGGGTTGGATCTGGTCC
GACTGGTCGTGCCGGAGCGGGTGGGACCGAATCATGATTCGGTGCGATCGTCAGTGCGCGGTTCTCCACTTCATCCTGAAAGCGCACGTGTCGATCCTCC
TCATCCGATTCGTCTTCGCTCTGTGCGATGTAAGCACGTCCCGCAGGTTTCGGTCTGTACCGCTCGCGATCTCGGTCTCGGTACGCGGATTGTCCGCGCG
GAAGTCGCGCGGTCTGGACGAGCTCTCGCGCGCACTGTCCTGGTAGCCGTCTTCATGCTGACGCAGAATGAACTCCAGGTCGTCGATGCTGTGTATGCGC
TGACTCTTCAGACTGGACCGCAACCTTGATTCGGAGAGGTTCCGGATGAACCACTTGATGTGCATCTCCCGCGTCCTCGGCGACTTCTTGAAGTTCACAT
TCGCCCTGTTCGCCCCAGCATTCAGTCGGTAGAAGAAGTCGAGGGTCGATTCGGTCCGCTTCTGAGCCATGGTATAGTATCGCTCCGAATCGGACACCTT
CGACCGACAGTACTTGTTCTTGAACGCGCGGGACAGCAAACTCCAGGTGTCGCGTGTGTGCCTCGGCAGTTGTTGACGCCAGTTGCGGGCAGACGAAGGC
AGCTTCAAACGCAGCTCGTAGACCATCATGCTGTCCGTCCAGCCACCTTGGACCGTCAGGGTGAGGAATCGCTCCCACCATCTTGTCCGTTCCTGGTATG
GGGCCTTGTCGTCGAAGTCCTCGAGCGAGCTGGAGCTCACATACGGTCTGAAGTTCATCACCGTCTTGCCATCCTGTGTCGTCACCGACGTGGAGTGCGT
GGGCACGGTCGCCAGCGAGTCGTCCGAGCCGCTGGAGCTGTAGCCTTCGTCGTAGCCGTCATCCGAGCTCGAGTCCGGGTCAGATCCGGAGGGGTCACCG
CTCTCGCGGCTCCGCCTACCGGATGGGCGCTTGTGCGCCCCAGACCCGGTGTCCCTCGCGTCCTTGGAGCCTTCCCCCTTCATGGGCGGCTTCTTGGCGT
CCTTCGCGGGGGCATCCTGCTTGCCCATCACCGGCGCAGCCTGCGCGGCGCGCGCCTTGGTCGCTCGCGCCTTGAGAACACCATCGATCGTCGCTTGGAG
TTGGGCTGCTAGAAGCTCGTCGGCGCGTGGCGTCGCAGACCCGATGGGCGCCTGGTCGGACTGGATAGGCGCACTTGCACCTGGGTGCAGAGTCGCACGC
CCGGTCTCTGTCTTCACTTGCGACATCCCGATGTTGCTTGAGCAGCTGGATTTTCCTGGCGTGTTGCACGAAGGTTGTGCAACTGGTGGGCCTGAAACCG
CTGAATGTTCCGGGAAGATTTTCGCTCCCTCTCTCGCTCAGCTTCAACCTTGTGGACTTTCTCTTGGAATAAATCCAGTTGAGCGTTCAGTCTCCGCTGG
ACGTCTTCGACCCAGCGTGCTCGGTCGGCTTCAGCCTGCGCTTCCTGCTGCTTCCAGCGCTCGGTGAACTCCGCGGCAACGCGTTCGCGCTCCAGACGCG
CCGCCTCGGTGCGGGCGCTCTGAATGGCGGCGGCGACTTCGTGCTCCTGGATCGGCGATACCGGGAACGGGCCGGACTGGATCGGGGGCTCCGGGACCGG
AGCATTCTGTCCCAATCCGGTCTGCCGACTACCTTGGAGGGCAGCGGCGCGTCCGGCGAGCTCCTGAATCGCGTGGAACGCGTTCTGGAGTCCTTCACCC
AGTCGAGCTGTGCTCGCAGCGGACGCCTCCTGATTCAGCTCCATCCTGGCAAGGGCTTCCTGAGTCTGGCGCATCGTATTGAGCGCGACTTGGGAGGCCC
CTGACATCACGGACATCGCGGAGTGGCTGGACCGACCGGATCGACTCGATCTGCTGGACCGACTCGGTGCGCGCTTCGACCTCGACGATCTTCGGTGGCG
ACTCCGGTCGTCCTCGCTGGAATCCGACTCGCTTGGTGACGGACTCCGCTTCTCGCGCCTGGACGTCGTTCGCGGACCGGATGACGCTCTCGACCTTCGG
TCACTCCGGACGGTGGTGCGATCGGACTCCGACATAACGACATCGTCCTGATCCACCGCCGTCGATGACCGAGGGAGTGCGCTCCGGGTGATCTCCACGG
TTCCTCCGCCAGTGCCGGACTGAATCATCCCTGCTTGCGCGGTCATCACCATGGGTCCGTACCCAATCGCGGACATGTGCCTCGCGGCATCGTGTCCGGA
CCACAGCGACGACGAAGACGAGCTGCCTCTGGACGCCGAGCTCCCGATGCCGCGCTGAATGTCGACTCGTTGGATCCGGCCGTCGTACCGAACAAGCTCG
AATCAAGATCCGAGGGCGAACGGGACGGCGGACCAAATTGAACCAGCGCTCCGGTACCAGATGCGCGTCCAGACTCGCTGGATGCGTGGTACGAAGGGAG
CGACGAGAGCGACGGTGTGGACAGCGGCGGCGCGGACGGGATCGACGATGCGGACTGGATGGACGACGGGCGAGGCGGTCCGTACTGCGAGCGCTTGGAA
TCCGTTTCGCCGGTAGACGACCCTTGCGGGCTCTGTGTCCGCCGGAGTCCGGCCACTCGTAGACGCAGGACAAACTCGCGACCCA