Description :
From Genome Similarity Track
Location :
contig_44:389725- 391201
Transcript NameFunction/comments
g9395.t1XP_009537557.1 hypothetical protein PHYSODRAFT_550657 [Phytophthora sojae

Sequence
1476 bases(100 bases per row)
CAAGTCAAGATGCCCCCGCAAACCGTGACAGATGAGATGTACTCGGAGGTTGTCTCTCCTCTGGCTGCCGGCCCGACCGCCTTCGACAAGGCCAACAAGG
AAGCCGAGCGCAGCATCAAGCCCAACGTCATCCTGTACACCAGTGTGCTGGTCGCTCTGCTCCAGCCGTTCCAGAGCGGTTGGTCGACGTCGCAGACCAA
CCTTACCCAGTACAACGACACGGACCAGTGTAATGCTCGCCCCGTGGTGGAAGATACGTGCCTCATGTTCCCGGGACACACGAAGTTGGAGTGGACGTTC
GCCGTGAACGCGTGGATTTTCGGTGGTATGATCGGCAGTCTGTTCTGCGGACACTTCAGCGATATGTGGGGCCGCAAGAAGCTGCTGTTTGTGAATTGCG
CCTTCATCATTGTTGGCGCCATCGTCCAGGCGGCCGTGTCCAACATTTGGGCGTTCGCCGCGGGCCGCGTCATCGCTGGTATCGCCTCGGGTGTCGCTAC
TGGCACGTTAGGATCATACATCAATGAGTTGTCGCCGCCTCACCTCCGCAATATTCTGGGTCTGGGTCTGCAGATCTCCGTGACCATGGGTATCGTGCTG
CCGGCGATTGCCTTCTTCTTCGCTAACACGAGCAGTGGCTGGCGGTACCTCGCGGGCTTCCCGGTCATTCTCGCTGGCATCTTCCTGCTGCTGGCCCCCA
AGATGTGCGTTGAGAGTCCTGCCTGGCTGCTCATGAAGAACCGCCGCGCGGAGGCGAAGGAGGTCATTGCTCGCCTGTACGGCGAGGAGAACATCCAAAT
CGCGCTCAACTGGCTCGAGCCTTCCAGCAAAGCGAACCAGTCCGAGCTGGGCGAGGTTAACACCGAGTCCCAATTGAAGGAGTCGCTGTTCTCGCCTCGA
TACCGTATGCAGCTGGCCGCTGCTATTTTGCTGTCGTGTGCCCAACAGCTTTCCGGTATCAACGCCGTGTTCTACTACTCCAGTAGCATCTTCGCTGACG
CTGGTATTTCGGACTCGCGTATCGGAACGCTGATCATCGACTTCATCAATATTTTCCCTGGTTTCGGGGCTGGCGCTCTGGCTGTCCGCTTCGGTAACCG
CCAAATGATCCTCTGGGGCATTGCGAGCATGTGCATCATGGCTGTGTGCATGACCATCGCCTTCTTGGTGAATGTATCGGCACTCTCCATTGTCTTCACT
GCTCTGTACGTCGTCGCGTTCGGCGCTACGATCGGTCCGCTGGTGTGGGTCGTCACTGCCGATTTGTTCCCGGACTCCATTCGTGCCAGCGGCTCGTCCT
TTTGCATCGGAATCAACTGGCTGTGCAACCTGATTGTCGGTGTGGCATACCCTTACATTTCGGACGCTCTGGACGACTACGCGTATCTGCCGTTCGTGGT
GCTTCTAGTTGTCTTCTACCTGCTGGCGCTGAAGCTGGTGCCGGAGACCTCCGGTAAGAGCAGCGAGGAGATTCAG