Description :
From Genome Similarity Track
Location :
Scaffold_47:38972- 49502
Transcript NameFunction/comments
Hyaar_Emoy2806177predicted protein
Hyaar_Emoy2806176hypothetical protein
Hyaar_Emoy2806178PREDICTED: diphthine--ammonia ligase-like isoform X3

Sequence
10530 bases(100 bases per row)
CTTGCCGTGATCGCGGCACGACCCGACGATATTGCGTTGGAGCGAAATAAAATTCACCATTGTACTGAGCTGACCCAGACTCCATTCTGCACAATGCTTC
TCTGAGATGCTTCACAAATTTAATTGGAGGCTGACAGAGGTGTGAGCCTCTGTGGACCAGCTCCAGAGAGTTAATGCAGCAATCAATCAGGACGTCGCAG
AGCTAGCTGTAAGCCCTTGCCATTGATGCTTTATGCGCCCACAAACGTCAAGTCTACGTGCCTTCCACCTTAAGTCGCCACATCGTTATCGCTTTGCTCC
TCGGAAATTTCTCCGCTGGTCTCCACGACACGAGGGGTGCATCCACCGCTTGACATTGTGTCGTCATTCACGGGAAAAAGCTGCTTCAGTAAAGCAGAAT
TCGAGCGACACTTGTCTTCCAGCACCTGCATTAAGACATCAAGCTGTCCCGCTTCGAATAAATCTTTCAGCTTCGGTGTCTCTTGCTTTTTTGCACCATT
CTGCTTCTGGATCTCGTCTTGAAGCACTGCCAAGCGTCTCACAATTCCTTTACTGTGTTCGAGAATTTCTTCATGGGCTGAAAGCACGCTTCGGCGCTCC
AATGTCGCAATCGCGACTTCGCCACTAGCAGGCCCATCCGCGGAGGACGAAACACTATCGATCACAGTATGCTCAAGCAACCCCACCAGCAGCTCACACA
CATTTTCCCACACAGCCAGAAACTCGGGGCACATCTGCAGGTTTGTCAACTCCTCGCAAACTACGAGCGAAACCAACTGGACCACCACCACATGTGGCCG
AAGTGCTAACGGGTCTTTCAATATTGATGACCGACGTCGTCGTCCAGCGGTACCGGAAGTGTCGTTGGGGAACGACACATCAGTAAGAATCGACGGTAAT
ACATCTTCGTCAAATGATGCGAGTTGTCGCCGGTAGTACAAGAAGGGTGAGCTGTTCTCCTCCTCATCGTTACCGACATGTACAGCTCGGCCATATCGGT
TGGGATCCATATCGTTTAGCAAGTCGTAACCAATGGGAAGCAAACCGTATCGAAGAATATCAAGCCAGGCTGCAGACTGAAATGATTGCTCAGATCCCGT
GTGCTCGCGTAACATGTGCATCAATGCTTCAAACGCCGCCAGAACGAGACCGTTAGAGATCTCTTGCATCGCCTGGTTCAACAGCAATTGCTTCGATATG
ACAGTCATGCCACCCAAAAAACGCAAGCGTTCTATCACAAAGTCAGGTGAATCGGGGTAAAGCGCATCAAACATAAAGCAGAGTAACTTAATCGGTCTCG
AGGGTGTCCATGAATCATATGGATCACACCTTCTCATGGCGAACATAATCATCTTCGTGTAGCAGCAGCGGATAAGCTTTTCGTTCCCACTTCTATCCCA
GACCTTATTTATTACAAGCTGTTCGAGTAGTTCAAAGGCGTGTGAGGCTGCGTGGGGCATCTTGACCGACAAGCTGATCAAGCTGCATATTTTCTCCCAG
TCCATGCGTGAGTAGTGCAAATTGCTCGGCTGCACCATTGTTACATATCGGTTCAGTCCAGACATAACTGGCGTCAGGAAAGGTCGAACGAACTCATCAT
CTGCACTCATTTCCGTTAACATAAACAGGTAATTTTCCAGCGGCAGCCTATTAGCATCACCACGTGTGCAAGTTGCCCAAGCAAACAATGTATTCAGTAA
CTTGTACAATAGAAAGCATGCGTTTTCGTAAGTCATTCCACTAGAGCGATTGTTTGAAAGTAACATCGGCCGTAGAAGCTCTAGATGCTGAATAATGTGA
GCTTCAAGTGCAGCAGATATTCTGCCTTTTTCACCCGCAGCATCGCCGTTGCTGAGAGATCCACTGAGCGAGATTATCTGGCACAAAAGATGCTCAAATA
ACACGCAGCCTCCTTGGCTGAGCGCCAACTTAGCAGCTTCTTTTCGGTCTTTTTGCGCATCAGCACCTTGCAGTGTTTGATGTAATCCATCACACAATGC
CTCGATAACTTCAGCAAGAACACGATGAGGCAAGTCAGCTACGTCTTGTACAAAAAAATCGAGTCGGTAAGGCTCCAGTGATGTCCGAATCCATTGGTCG
GTGCCGTGTTCACTCCTTGGGTCGTGTTCACTGTCGAACGTGTGTGTCACTGGCGCATTTTCTCCAACAATAAGGTCATCAGCGTGAGAGGCCAGCTCAG
CCGGACTGAGCTGATACCAGGGAGAACACTGAGAACTTGTCGTCGTACCAGATGTTGATGCTGAACTACCAACACTGGAGTCGATAGCTGATAGGAGCCA
CGCGACACTGCTAAAAAAGCCACCCGCATCTCCATTACCACCGTCCTCGTCTTGTGCGCTAAGTGCAATCTTTCTGTCTAGTTTTTCTTTGTTTTGGTAC
ACCAGGTCAATGAACACTAGGCGTTCCTTGGCTGTCAATAACTCCGATTTCATGTCATCGCTAGGATACAAGATCCGAGACGGGACAACATGAAATTCAC
GCAAGCCATTAACAACATGAAAAAAATACTTCCAAGAGCGACTACAAAGCAACAAGCTGCATGTACTCAGAAGTTTGAGTACAGCTGCAGTCGCGACTGG
AGCACTCTGGTTGTCACAATACACCCTAGCTCCGTTCTCGCGGCCGTTGTACCCCACAGGATAAACGTCCGACGAAAGTAGCGCCGTGTACTTGCAAAGG
CGGACGAATACAGAGTTACAGTACTCCACTAACGACAAATGATATGCTACCGTTGCACATAGCACAAGACCATTGCATGCAAATTGCAAAGCACTTTTCT
GAGGAACATAGTGCATCTCATAGCCGCTACCTACTGAGAGATCTTCGCCCCGAGCTGCATCTCTTGCTTGAGAATCCACGACAAATTGTTGAAACACGCT
GCTGAACGCCCGAACAAGATTTTGTTGCACCAGCTCGTAAATGTGGCGATCATACTGATCACCTGATGTAGCATAGCGAAACTTCAGTTCATCTTGCTGC
TTCCATGTGGTGTCGCTTTCGTGCAACTCAGCAGCTCCGTAAGTGGGGCTAGAAACACTCGGCGCTCGTCGAGTTTGCGTCATCGATTGCATAGCACCAG
GTACTGGGGGTGACGCTGAACTTTCGGCAGCTCCAATACTGCAGGGGGCGCGTAACGACGGACGGAGCATGATCAAACGCGAGTTGCGCGGATCGCTTTC
TGCTCGATTGAGCAAGTCTTTCCATCGAACGCTCGTCACCTCACCGTGTTTGCCACCGTCTTCGAACGTCCTAATCTCCTCAGTTGCAATAGCGTTGTAC
AGTTCCGCCAAGAAGTCCTCAGGTAAATCGAGGCCAATGGAAACTTCGTGACCATAGTTTTTGTTGTTCTTGATAAAGTCAGCCAGCTTCATTTTCTTGT
CACCTCGGATATTCGAATTGTGCAAATCTGTGTTGAGCATTATCAGACTGAATGATAGCAAATATGCTACGTCCATTGAAGCCATGACAAATCGCTCCCG
GCACTGTTCATACACTTGAAGCGAAAAGACGTTGAGTATGCGGTCAATTTGTTGAGCCTCTCCTGGAAGACGAAAACTTGCGAGGAACATACGCAGCGCA
GTAACGATGCTCTCTCCTTCAAAATTAAACGACCGCACAAAGTTGGTAAGGACATCACGGTGAAAGTCGATAGTATCGGCTTCATGGATATCGCTTTTCT
CAAAGCCCTTCACTTCCTTGCCTATTGCACCCAAGTATACACCGACCGAGGTTTTGCTTAAATCTTGAGGAAGAGATCGGAGGAACATAGCAAAAGACTT
GCTGTCGAGCGGGATAGGCAGGAAGCCATTCTGCTGCAGGTACTTGATTCCCGCCAGTGGCTTTCGATTGAACTCCTGAATGCCGCGTTGAAAGAACTTT
TTACGCTTTTGCTTTTTGTACAGTGCTACTGCAGAAACAAGCTCGGCGCCAGCTAGTAAGCATTCTTCGCCCTCCTCAATCACAAGCGCGTCCTCATTGT
CGCTCGATCCACTACTATCGTCACCACCCAGAACAGGCACATTTTGCTGTGTGCGGGTATACACGACGTGGAGTGAATTGTACAGTCCTCGAAGGGCAAT
CTCACCAATTGCCTGAGCCCAAAGAAAGTGCGATTCTTCGTGTGACTCAAAACAAGCAACGTGGGACTGCTGAGCCACTTGCGAAAGTAGCCCAAACAAA
GTCTGCGTCAAGTCACAGCGATTATCATCGCAGTCGTAGTTGACGTACAATTCGGTAAGCAGCGTTGCCTCAGCAAGCAGGTCCACTAAGCAGTCAAAAA
TTTCAAACGAGATGCTGTACAGCTGGACCTTCGACAACATATCGCCGGTAAAATCGTCAAGCGCAGACTCTACCAATGCAGCAGGTTTGTCGTCTATCTG
ACTGTCCATGTTTTCTACAGATAGAGCTACATCATCTCCACGCGGAAAATCTGGGTTGTTTACATTCATATTTGACAGACACCAGTGAAGCGTGTGGTAA
AACACGCCATCAAAAACTGCCTCGATTTGCATTTTGATCTCTGACCGAAGCTTTGACCATAACAGTCTGATAATTTTCAGACAAACGATAGAAATATTCT
GCTCCGTGCAAGCGCTGCACACCATCACAAGTATGTGTAAGAATTAGATCAGCATACGAAAAAGCACTATGCAAAACGCACCCTAGACGACAGTAACGTA
GAACGGCTTTACACAAATCATCCTTGATAAAAAACATCAGCGACGGCACACCCGTAATCAGTTCGGCATCGCAAGCGACCAGCGCACACTCGAGTAAGTT
GAACGACAGCAGCACTTCACGTTGGCGAATTGTGCTTCCAGTAGACGATACAGCGGCATCCGAATTGGAAGATGACGAATCGTTTCGCTGGTGTAATTTC
TGGCATAAAAAGCCCATAATTTTTACTGCACAAGGCAGTCCAAATCCCGTTCCAAGCGAGGACTCGGTATTAGCAGCGAAAGCAGAATCCGCATATATCG
CAGGGTTAGAAAACACAAACGTCACTGTATTGTGTAGGAAAATCATGGCGGTCGAACGCAACGGAAGCGTGACGCGTGACTATATAGACCACATCAACCA
AGCAGAAAAGCGATTAGTACACACCTTTGCCCAATCTACCCACTAGAATGCAAAAGCCGCAAGTAAGCAATGTCGCAAATCGCACATCATACTGACTGCC
ACGATTGAGAGCGTAGAGCGACTGCACGAGCTGCCACATCGAGTGGTCCGACAGCCGAGCACCGTAAGGCGAGCGCATAACCGCGTGCAACACGTGGGCG
ACAAGCACCAGCGCGTTCTGGTTGCCTTCAATGCTCTCTGCTTGGAACCTGCAATGGCTCACTACGTCCACAATGTCAGACACAGTGTCCGCCGCTACGT
TCTCGTCCTGGACGTCTACCCATGGCCACAGTTGCACAAAACTCATCAACGCTTGTAGCGAAGCACTCGTCACCGCGCTGCTCGTGTGATTGTGTCGGAT
CACATCCAGAAACGGCTTTATGACGGTTAGAGGTGACAATTCGGTCACGTCTATTAGAAACAAGCAGAAAAATAAAAACACCGTGTCAAAAAAAGCGGTT
ACAGCTTCAACACTGCGCACATAAAAAGTCTCTACGAACCATAGCAATACAGAAGACGTCCACGAAGCGTCAAAAGACTTTGTAAGACCGATACGGAGCT
TTCCTAGGTCCGTATGACATGAACACGTAACGATCAGTGGACTAGTTTCAGGCATGAATTACACCAGTACAAAGATACTTTCATACATCCTCCGTCTCTA
GACTGGTAGTCTTCGATATCAGGTATCCATACTGATGTCGCGCGAGACTCAAGACGCTCTGGATGTCGCTCAACAGCACAGCCCGCACGGCTGCCATCTT
CTCACTGCACAAAAGCATTGTTTCGGTCCATTTTGCCGCCCGGTCGCGAGTTAAGTTTATTACGTCGACCACACCATTATGGTGTGGTGCACACCGTCGC
CATCCCTCGCCCACTGTCATGGATCGTGTACACCACACAAAACTTGACTCACTTGACACGACCAGCACATCTGCTCGACGCCTGCCATGCACGTGGTGGC
GCTCGTAAGCGGTGGCAAGGACAGCTGCTACGCCATGATGGAGTGCGTCCGCTACGGCCACAAGATCGTGTGTCTTGCGCACCTGCATCCACCCACTCAT
TTGTCCGCAGACGAGGCAGAGATCGACTCGTTCATGTTCCAGAGTATTGGGTACCAGACCGTGGAGCTCATTGCCGCGAGTATGGAGCTCCCGTTGGTCT
CAGAGACGATTACAGGAACCGCCGTGAAGACGGAAATTGACTACTATGATTCCGTTGCTGGAGATGAGGTCGAGGACCTCTTCCGTCTACTGCAAAAGGT
CAAGCAGCAGTTCCCAGACGTTGAGGGCGTGTGTGCCGGTGCCATTTTGTCCAATTACCAGAGAAATCGAGTGGAAAACGTGTGCGTAGGAAGTTCTAGG
ATGTGCTTTTTGTAACAGAGTGGTGTAGAGCTGACGGCGGTGATGCACAGATGCTCGCGACTTGGCCTGGCGTCGCTGGGATACTTGTGGCGTCGCGAAC
AGACCGAGTTACTGCAGGAAATGATTGACTCGAATGTGGAAGCCATCTTGGTCAAGGTGGCATCCATTGGTCTGGATGTTCGGATGCATTTGGGAAAGAC
GATTGGCGAGCTACAAGGTCAACTCTTGATGCTGGTACAGTAGAAAATTGTCGTCATGCGAACGCTGGATACTTTAGATGCTTCGTTTTTGGTTCCCTTC
TGTAAGAGTGACGTGTGGTTGTTGATGTTGTTGCTGCTGGCGGTCTGTGCAGAAAGAAAAGTACCAGTTGAACGTCTGTGGCGAAGGCGGAGAGTACGAG
ACGTTCACTTTGGACTGTCCGCTTTTCAAAAAGCGCATCGTGATGTAAGCTTTTACGATGTTAGCCGATAGTTGTGCCGAGCAAACACTAAAGATGCGAC
GTTGTGTTGTTTTTGTGCTTTAAAGCGATGAAAGCCACACGGTGCTACACTCGGACGACTATGTAGCTCCAGTAGCCTTCTTGTCGATTGACAAGTCCCA
TTTGGAAGACAAGGAACCTTTGGACTCGTTGCAACTAGTGTCTCGGGTCCCTGAACCTTCGCTTTGGCAACGACCAAGCAGTGCGACGAACGCAAACAAA
AAGCCTGCCACCGTGCTAGCAATTAGCCCGCAGTCTGCGAAAATTTTCCCTGCTTTCGGCCGATTCCGCGACCAACTGCACCTGTCAGGCCTCATGAGCA
GCAGGGCTGGTGATGCATCGGTGTCGCTGAAAGAAGAAATGGTTGATATTTTTGACCAGCTGGAGACTATTCTTAGAAGTCAAAACATGGTAAAAGCAGA
CGTGTGCTATCTGCACCTGTATGTACAGGATATGGTTGCATTCCGTCAGCTCAACGTCGAGTATATTCGATACTTTGGGCAGAACTTGCCGCCGTCGCGT
AGCTGCGTCGAGACGAAGGCACTATCGGATGTGCCTGCTCGTGTACTTTTGGACTGTTTCGCGTTGCGTGGCAGTGGTGAACAGAAGTTGCAATCGCTGC
GTGTACGCCGCGACGTCCTGCACGTGAAGAGTATATCAGCCTGGGCGCCGTGCTGCATTGGTCCATACAGCCAAGCGAATGTGCTTCATAGAGCTCTCAT
TTTGTTGGCGGGTCAAATTGCGTTGTATCCGCCGACTATGGACCTCGTGGCAGGTGGCCAAGCCGTCCAGGCTACGCAATGTTTTCGCAATGCCTGCCGT
GTGCTAGAAGCCCTGCAGTCCAATCTCCGCCATGTGTGTTCCGGCGTCATATACACCACTGGAGGCGCTGACAATCGAGAAGCTCGAGTGTCTCTAGCAG
CTGATAGCCGTCACCATCTCGTTACAAACGCAGGGTTGCGCGATGAGTTTGAGTCGGTTGATGACAGCGATGAAAGCGACGACGAAGTGAGCAAAAGTGA
TGCGCGCTTGGAGTTCGTGAAACAGGCCCCGTTGCTGGTCGTGCAGGTGTCGAATCTGCCACGCGATGCTTTAGTAGAAATCGAGCTTCAAGCACTCACG
CATATTGCACTGAAATATTTGGTACCGCGCAGCTTGACGTCTTCACGCTGTTCAAACGATATGCGTTTCGACTGGCAGGTTGGCATGATTCCAAGAGCTC
TTTGCCAGATCGTGTGCACTGCGTCGATTGAAAGCAGTAATCGGTACTCCGATACACGAGCGTTGGCGAAAGCAGTCGCAGAAGGGACTTGGGCTTGCGT
GCTGGACAGCCTGGTGGAAGCCTTAATGCCTTGGGACCGCGTGATATTCGTGCGCACCTTCTACGTGGCAACAGCTTTCTCAAGCGAGGAGGAGCTGGCT
AAGACGTATTACGAGACTGTGACAGCACGGGGTAAAGTTAACAGCATGCCTGGCATGACGTTCATTCCCGTAGATGCTGTCCAGAGCGATGCAGTAGTCG
CGCTGCAGGTAACAGCACAGGATCTCGATAAGCTGGAGACAGAGCTCTGGCTGCACAAGCAAATTTAGACAAATGCCACTAATGACTCAGGCAAACGGCA
GGCGACATAAGTATATCAACAAGTTACGACACAAAATTGCGTACGATGCTGTACTGCCAGAATGAAGTTGTAATCGCTTGCATGTTCATCGTCTATTGCC
GCCCCGTTTGTGGCGCTGGTCACTCGGAACTCGATTGCCGCCGGAACTTTCGTCCCGATCTTTGCGCTTACGTGACTCACGGTCTCGGGATCCCGAACGC
CCGACTCGGTCTCCTCGGTTGCGTCCTCCCCGCTCCCGATCTTGAGCTCCTGCTCCACTTCCTCCACTACGTTCGCGCTCTCGAGGCCGGCGATCACGAT
CACGATCAAGGCCACTACTTCGACCACGACCAATATCACGGCCACGAACACCATCACGGTCTCGGCCACCATCACGGTCTCGACCACCCTCACCTCGGCC
ACCATCACGGTTACGACCACCGTCACGGTCACGACCACCATCACGGTCACGACCACTATCAACACCACGGCCACTATCACGATTACGGCCGTTGTCACGG
TCTCGGCCACTGTCACGACCGTCAGCACGGCTTCGGCCACTATCACGATCTCTGCCATTGTCACGGTCTCGTGCATGGCCGTTGTCGCGATCTCGCTCAC
AGCCAGCGTCCCGGCTTCGTTCGCGATTTCCGCCAGGGCCACCGTCACGGCTCTTTTCACGGTCCTGGTCACGCCCGCGCTCCCGACCTTGGTCTTTGTC
ACGTCCTCGGTCCTTCTCGCTATCGCCTTTGCCCTCATCCCCATCTCGACGTTCACTACCCCGCGAATCATCTCGACGGGGACGATCACGAGGTCGAGAG
GATCGATCGCGACTTGTTTCTCTTGATTTACCAGTTTCTCTTGATTTACCTCGTCTGTCGTCTCGGTCATCCTTCCCACTACGATTGCGATCGTCAAAGC
CGCCCCGACCACCACCTCGACCTCTACCGCCGCCAGGTCCACCGATCCAAGGAGGTCCTCTCCCCGGTCCAGAAGTCCATGGCGCTCCCATGGGAGGCCC
ATTCCAGGCCTGCTGACCCATAAAGTTTGGTGGAGGCCCCATTCCAGGGTGCCATCCCCTCGGCGGTTGTCCACCGATAAATCCACCTGAAGTTCCTCGG
GGTGGTGCGCCACTCATCGGAGGTATACCGCCAGGACCCCACTCAGCCGCTCGACCATCCACATTCGGGTTGTCTCCGCCTTCAGACTTCACCGATCCAA
GAAATCCACGACCAGGGGGCATGTCTCCTCCATGTCCTTGCAGTTTCGCATCCCGATCACGGATCGTCTGCTGCAGGTTCGCTGCACTCACCGCCTGTCG
TGACGCCTGTTCTCTCGACTTTTCAATTGCCAAGTCGCGTCTCAGCTTTAACTGCTTCGCGGCATACTCTCGCCAGCTGTGCTCATCAAAGCCGTAATTA
AAGTAATCCGAGATATCCACACCCGGTTTGCGCCACGGTCGGTCTTCCAGCAGGTCAATATCCACGTCAAAAGCCGTGCGACGGCCGCCAAACATGGCCA
TATCGTCCACACCATCAGTTGCCACTGCACCGGCATCTCCAGTCTGTGCACTCGTCCCACTTCCAGTCCCTGCAGTGCTAGCCCCGCCAAGTTGGGAGCT
GCCAAAACTGCCTCGTACGTAGCGATTCCCCCCTCCCGTAAACCGCAGCGTCGGTTTGCTGCTTGAGTGATCCGTACTTAGCAAAATAGCCACGTCTTCC
TCCTCCTCGTCCTCGTCCTCGTCGTCGTCCTCCTCCTCCTTCTCTTTCTCCTTAAGATCCACCGACGCGTCTTCGTTCAACTTGGACACAGCTTCTCCAT
CTTTTATAGAATCACTAGCACTTAAGGCTGCGGCTGACGCTTCTGCCGCTTGGGACGTGGCTGACGCGTTCAATTGGATCGAGACGCCGCCATAGAGCTC
TTCGTCCTCATCTTGTTCCTGCTCGTCCTT