Description :
From Genome Similarity Track
Location :
contig_44:389708- 391184
Transcript NameFunction/comments
g9852.t1XP_009537557.1 hypothetical protein PHYSODRAFT_550657 [Phytophthora sojae

Sequence
1476 bases(100 bases per row)
CAAGTCAAGATGCCCCCGCAAACCGTGACAGATGAGATGTACTCGGAGGTTGTCTCTCCTCTGGCTGCCGGCCCGACCGCCTTCGACAAGGCCAACAAGG
AAGCCGAGCGCAGCATCAAGCCCAACGTCATCCTGTACACCAGTGTGCTGGTCGCTCTGCTCCAGCCGTTCCAGAGCGGTTGGTCGACGTCGCAGACCAA
CCTTACCCAGTACAACGACACGGACCAGTGTAATGCTCGCCCCGTGGTGGAAGATACGTGCCTCATGTTCCCGGGACACACGAAATTAGAGTGGACGTTC
GCCGTGAACGCGTGGATTTTCGGTGGTATGATCGGCAGTCTGTTCTGCGGACACTTCAGCGATATGTGGGGCCGCAAGAAGCTGCTGTTTGTGAATTGTG
CCTTCATCATTGTTGGCGCCATCGTCCAGGCGGCCGTGTCCAACATTTGGGCGTTCGCCGCGGGCCGCGTCATCGCTGGTATCGCCTCGGGTGTCGCTAC
TGGCACGTTAGGATCATACATCAATGAGTTGTCGCCGCCTCACCTCCGCAATATTCTGGGTCTGGGTCTGCAGATCTCCGTGACCATGGGTATCGTGCTG
CCAGCGATTGCCTTCTTCTTCGCTAACACCAGCAGTGGCTGGCGGTACCTCGCGGGCTTCCCGGTCATTCTCGCTGGCATCTTCCTGCTGCTGGCCCCCA
AGATGTGCGTTGAGAGTCCTGCCTGGCTGCTCATGAAGAACCGCCGCGCGGAGGCGAAGGAGGTCATTGCTCGCCTGTACGGCGAGGAGAACATCCAAAT
CGCGCTCAACTGGCTCGAGCCTTCCAGCAAAGCGAACCAGTCCGAGCTGGGCGAGGTTAACACCGAGTCCCAAGTGAAGGAGTCGCTGTTCTCGCCTCGA
TACCGTATGCAGCTGGCCGCTGCTATTTTGCTGTCGTGTGCCCAGCAGCTTTCCGGTATCAACGCCGTGTTCTACTACTCCAGTAGCATCTTCGCCGACG
CTGGTATTTCGGACTCGCGTATCGGAACGCTGATCATCGACTTCATCAATATTTTCCCTGGTTTCGGGGCTGGCGCTCTGGCTGTCCGCTTCGGTAACCG
CCAAATGATCCTCTGGGGCATTGCGAGCATGTGCATCATGGCTGTGTGCATGACCATCGCCTTCTTGGTGAATGTATCGGCACTCTCCATTGTCTTCACT
GCTCTGTACGTCGTCGCGTTCGGCGCTACGATCGGTCCGCTGGTGTGGGTCGTCACTGCCGATTTGTTCCCGGACTCCATTCGTGCCAGCGGCTCGTCCT
TTTGCATCGGAATCAACTGGCTGTGCAACCTGATTGTCGGTGTGGCATACCCTTACATTTCGGACGCTCTGGACGACTACGCGTATCTGCCGTTCGTGGT
GCTTCTAGTCGTCTTCTACCTGCTGGCGCTGAAGCTGGTGCCGGAGACCTCCGGTAAGAGCAGCGAGGAGATTCAG