Description :
From Genome Similarity Track
Location :
Scaffold_1246:3897- 12111
Transcript NameFunction/comments
Phypl_g12879hypothetical protein
Phypl_g12880hypothetical protein
Phypl_g12881hypothetical protein

Sequence
8214 bases(100 bases per row)
CCTACCCGGTCGGACGATGCGGCGCGGAGCGTGTCGCGGATCGCCGCAGATGCGGCGAAGACGGGGCAGGTACCCACAGGTCACATGGACACATCGCCGG
ACTCATCAGGCGATGATCAGAGGCTGGATCAAGATCCGACGGCGCTGCCTGATCAGGACCCCAGAAAAGAGGTGCCTCTTGAAGATGAGCAGATCTGCTA
TCACGAGAGTGGTGAGCTGTTTGCAGAAGATGTGCAAGGTGAATCGGCGGTGGTGCCTGAAGTCACACTGACGACCGACGAGGTGACGATTGAAGATCTT
CAGGTGGGAGATCCCACGATCAACACACCGGAAGAGATCGACCGCCTACGGAAACGGATCTGGCGATGTCGACATCTGCTGACAATCCGTTGTCTCCGGC
AGCGTGGGGAGTCGTGGGCGATATTGACGTGGGCAATGCGCGGCCGATCGCACAGCGGGTCCGTAAGGTAGCACCACAGTTCCGAGAAAAGTTGTCGGAT
CTGATCAAAGGACTGCTGGGAGCCAAGATCATACATCACTCTACGTCACCATGGGCTTCGCCCATCGTCGTgatcatcaagaagaacggtGTGAACATTC
CTCTGTGTATTGATTACATACTGGTCAACAACCTCACTCGACTGATGGTTTACCCAATCCCTCTGATCAATGATCTGATCGAAGATCTAGATAAAGTACT
GTGGTGTTGTTCGCTGGACATGGCGAGCGGGCTTTGGGTAGTGACGATGACGGGTCGGGCTCGTGCGATCTCGGCATTCATCACCCCATTTTGACTTTTT
GAGTGGAGTCGGATGCCTTTCGGCCTCAAGAACGCCCGCAGATCTATCAGCGCTTGATCGATAATACGTTGTACGGATTTACGCGGATCCCGCGTTCTGG
GGCTAACGGGGAACTGACAGATCTTTTTGAGACAGGAGAACCTGAAGATCCTGGTAAGCCTTCGGTGTTGGGTCGTAGATCTTATATCGACGACATACTG
ATATCGGCGAGATTATGAGATCAGCTATGCGATCAAGTGGATGCCCTACTGGAGGCGTGTGACAAGTGGAACTTATCGATCAGTGTGGTGAAGAGCTTCT
GAGGAATGAACAAGGTGGAATACCTGAGACACCGAGTGTCGAAGGATGGGTTGGAGGCTAAACCCAAAGACCTGACGGCATTGACATATCTGCCATTTCT
GGCGTCACTACGATCTATGCAATTTTTCCTGGGCATCCTAAACTACTATAGTCGCTTTATCGAGGATTATGCGATCTACGCGTCAGTGCTGTATGAGTTG
CGAGAAGTTGATTTCGCCGCCATGACTAAGAAGTGGACCAGTGACCAGATCAGGATGCTCCTCGAAGTGGAGACCTCCGATCGGGATACCACAGATCTTG
ATCTGGGAGatcggggggggggcagcaGATCAGGTAGCACAGGACTGCGGCGATGTGGGCATACGGTGGATCCATGCGCAGCGGGCGTTCAAGAGGTTGA
AGGAGAAAATcgcgacgacgcccgtgCTGCGGCATTTTGATCCAGATCGCCAGACTGTACTGGTGGTATATACCAGCGATTGGGTTATATCAGCAGCCCT
TATGCAGGAGTACGACAAGGTATACTATCCGATTACTTTCGTGAGCCGTACGCTCAAAGCGAACGCGTTGAATTATGGAGtggtcgagaaggaggtATTG
GCGCTATTCCGGGTCTTGGATCTCAACTATAATCTGCTAGTCGGCCGACTCGTCCGGATCCTAACCCGGCATTCAACACCAGCATGGCTGTTCAGATCCG
CTGGCCCCCAGGGCCGGTTGGGTCAGTGGGCGGCGGTGTTATCGCCTTGGACGCTCGAGATCGTACGATGCTCGAAAGGAGAAGACGAGATCCTGggagc
gcttgctgccagtATCACGCCCAGATCGGAGGTCGACAACGCCCTGACCGCAATCGCCCCCAAGTAAGAGCCAAGGCGCAAGATCCAAGCCCCGATCCCG
ACCGTGGGAGCTGACGAAGAACTGTTCGTGTTGAGTTTCGATGGATCTGCTaaagaggaggaggcgcctACAGTGCGATCTTGTGGAAATTGCCCGAGTG
GACAGTGCTGAAAGCCAGGTCACGCTATGCCGACAGTCTGACGGTCAACGAGGCAGAGTATCATGGGCTCCTGCTATGCCTAGATCTCCTCGAAGAGGTA
GATCGGAGACACGTAGTGATCTGTGGCGACTCGAACTTGGTGGTTCGCCAGGTGAGGGGCAAGACCGATTGCAAAGCGCCGGGGCTCACACTTCTGAGGC
AGAGGGCGCTAGATCGGTTACAGACATGGCCAGATCATGAGTTGGTCCACGTAAAGCGTGATTGGAACGGTAGTGCAGACAACCTGGCTGGAGCAGCCCT
CCAGCGTCAGTACGGGATCGAAGTTGAGGACGAGTCCGAGGAGCAAGATCTGATTACGTTGAACCGATTAGACGAAGTTCTAGTGGCGAAAACCGAAGGT
CAGGTAGTGCGAATCTCGCCTGTACGAACTAGAGCCAACACCAGTTCCAGATCAAGACCCAGAGTATTGCAAGAAGAGCTCGTGCGGGACCTCCGGATCG
AGCGGATTAAGCGAGCACAAAACGAGGAGGCGTGGATCTCGAGGTTGAAGAAGTATCTGGCTGGACAGGTGGGTGATCTGACTCAAGAAGAGGCTGGATC
CTGAAGTAACATCGCTTCGGATTATGAAGTGGATCTTCATGATCTGCTTTTCTACTGTCCTCCTACGAAACGTGCGGACGCAGATCGAGATGGCTTCATG
AGACTGGTGGCGCCGGAATCCCTGCATCAAGATATCTTGCACCATTACCATGCGAGCTTGGAGGGTGGACATCAGGGAATTGGCCGTACATATCTACGGA
TCAGAGATCATTTCAACTGGCGGGACCTCTATGGGAGtttgcagcgccgtgttggAGGGCGTGTCGATTGCGAAACCGGAAATGGGCGGCTCACGATCCG
GGGAGAGTCGCCAGGGAACATCCAAGCAGCCTACCCGTTCCAGATCATAGCCATGGATCACATCCCCTCTCTGCCCAAATTCTACAAGGGTAATACGGAA
CTACTGATCTGGGTAGATCTGTTCACTGGCTACGCAAGTGCGAAAGCGAGCGCGTCAAGGACCGCGCAGACGATCGCAGAATCTTACGAAGAGTGCGTCT
TCCGCAGGTTTGGTGCCAGCGAAGTGATCCGGCATGATCGGGAACTAGATTTATGTCCGATTTCTTCCGTGCGTTTAACAAGATCCTGGGGCAACGTCAG
CGAGCCACGATGGCGTATCGACCTCAGGCTAATGGAACGGCCGAACGAATGGTGCAAACCGTGATCAGGGCTCTCAAGATGTACGTACAGGATCTAGATC
AACGGGATTGGGACGAATACGCCGAACGGCTCACGTTTGCACTCAACACCGCTCAGGATCGGATCCGCGGGGACACGCCTTTCTATATGGTACATGGCTG
GGAACCTGGATCCACCCTAGAAGCTACGATCCCGGTAGGAAGCACTCGTCGCCAAGATCGGGATCCACGACAGTGGCGGTATCAGGCGGTATCAGATCCA
ACGCTATTACCAACAAGCACGGGAGACGGTGAACGAGAAACTGCGAGAGGCGATTGCGGATCGAGCGGATCAGCACAACCGTGAAATCTGCCCGCACCAG
ATCGGGATTGGATCTCAGGTGTGGGTGTACCTAGATCGCGTCAAAGAGGGATACGCTCGGAAACTCGGACACCTGTGGCATGGACCGTTCCGTGTATCCG
ACAAGATTAGCAGCTATGCCATGAAACTCGAGATCTCGGGGACCGAATATCGCCTCTTCCCGGTGGTTCATGTGTCAAAGCTGAGGCCGGTGAGGGAATT
CCCTGATCGCCCTCAGATACAACTGACGGTCGTCGACGCGGATCGGTTTGATTTCAACGAGGCACTCCTGCCGGAAGACAGTTGGAGTCAAGATCTGGGG
CCTGACGAATACGAGGTGGAGAAAATTACCGATGTCAGATCAGGCAAGAGGACGAGATATGGCCGAAACTACCGGGAATTTCAGGTGCACTGGCGAGGTT
ATGATGACCCGACTTGGGTGGACGAAGCAGATCTGAACTGTGGAGCATTGCTACATGAGTTTCTGCGCGATCGCGCGAACAGCCATCGGTTCGGTGTGAT
GCAGTCTCATGAGGAACCATGAGGCTCTGATCTGTTGGCGTAAGTTGGTTACGTCGATAGATGGACGTGTTGAAAAAGCTGCAGGGTGGCTGCAGACTAG
GAGGGGTACATATGTATATACAGCACAGATCTGATGAGTGAGGTGTCGGATCACAAGATCCAGGTCTCAGACGAAATCGATTAGATCAAGATCTCGACGA
GCTGATATCCAAGTTCGCCGGGGGTCAAGGCCAATGGGAACATGTATTACGACGATAGAGAGTAACCTTATGGGGAGAGAGGCCGTCGATCAGGATGGTG
GGCCAGGATCCGGTGGAACTAGAGGGAGTAGAGCCGAGATTAGCATACGTCGGACTCAGATCCCGTCAGGATCCGGTGGAGCTAGGGTGCGCGGAGCCGG
GATCAGCGTATGTCGGACACAGATCCAGCACCCCCTAAGGGTGGGCGTTACCACTCCCACGTTGAAGAACTTGCCGGGTGATGGTCAGGATCGTCACGAT
ACTGATTGCGCTAAGGATCGGCGGCGTTGCACTCATCCAAGGCCTCCAAGAGATCGGTAGGCTCTGAGCGGTGCAGATTGAGATCGGTCACGTTGGCTTA
GCGGGACTCAGCACCCGGATACCGGATAACCTTGTCACCGCGTTTGGGGAAGTGCAGAAGGAAGAGGTCCAGAAGAATGTCGAGATGCCATCAGCCCTCT
CGCATCGCCTGGATCAGGGtcaccagcgccttcttccaaCCATTGCCGGCGTGACCCCGTCGGGTGTTCCGCTTGTGATTAAACACGCGCAGCCATGGGT
CCTGATCCATCTTCGCTTTAGAGACCGGGAATTTGTGAGTACTCTCCCAGATCGCAATCTGGTGTTTTGTCTCGATCTTGAGATAGAACTTGATGAACAC
GCCGAGGCGGCCGCCCACTCGAGGACGGAAGCTGATCGGGGTGAGGGGAGTCTGCAAAACGTCCCAGGGGTTCGTAGGTATCAATGCCTCGACGTTTGCA
CGTGTGATCAGGGAGTCGCAATCAGCAGACTCCGCTGGACCACGGCATTCGTGGAGGAAGATCCAACCCGGCGCGAACGGTAGAGATGGGAAGAGATCTT
CGACCACCATAGTTGCAATGGCCAAACCGTTGATCTTCTGGATCACCCACGGCTCGAtcgtaccagcagcaaatgTGCGGGGGCGCTCACGAACCGGGAT
GAAGGAAGTATCCGGCCCGAAAGGTGCCGAAGGCAAGAAGGGATTCGGAGGATTAGGGCCGCGAGCCCGGTTACCAGCACCCTGATTGGTAGATCCAGGA
GGCGGATCTGCGtgatcgtcttcatcatcaccCGGATCATCGGgatggccaccagcaccgctAGGCAGGTTCTTTCCCGGAGCcgagaggcggcggcgac
gcttGGAAGACTTGGACTGGGAGATCACCCTTTGGGTATCCTGCTCTAAAGCATACGCCACGAATCTTCGTTCCTCGGCTCCTTCGTCGGGGGCTTCAGT
CTCCTCGGCGGATTTGTGCTCGCTAGAGCCCAAACTTTCGCGATCGGCCACGGATCCCTCCTGATCCACGGACGAATTCTCCTGACCCGCCGCCGAGCCC
TTCTGATCAGCAGTCGACCGCTCTTGATCAGCGGACGAATGCTCCTGATCCGCGGACGAATTCTCCTGACCCGCCGCCGAGCCCTTCTGATCAGCAGTCG
ACCGCTCTTGATCAGCGGACGAATGCTCCTGATCCGCGGACGAATTCTCCTGACCCGCCGCCGAGCCCTTCTGATCAGCAGTCGACCGCTCTTGATCAGC
GGACGAATGCTCCTGATCCGCGGACGAATTCTCCTGACCCGCCGCCGAGCCCTTCTGATCAGCAGTCGACCGCTCTGATCAGCGGACGAATGCTCCTGAT
CCGCGGACGAATTCTCCTGATCAGTAGCCGAGTCCTCCTGATCTGCCGCTGAATCCTCCGCGGAACCCCCGCCCAGATCCTCTTGaccaccgtcgtcgtc
gatctcagCATCAATCCCCTCCGGTGTTAGAGGGCGCGAACGCTTGTGCGGGAGACGGGGTTCCGACTCGGAAGATGGCGATCTGCTAGGATCGCGCTTA
GAAGAAGCCGAATCGGAGCCCCCGTCTTCGACTGGGGGCGGGCGGTCATCCGAAGGATCGCGATTCAACAATTGCAGTGGAGGCAGCTGCTCCGGGTCTC
CGCGCGCCAGAGATGTGTACCGAGGATTGTCCATCACACGAGCGCCACCGGCTGTAACCGCGACTTGCACCCGCTGACGGAGCTCATCTCGTTCTCGGAT
GATGATATCGCGGTCTTGCGTAAGCTGATCATGATCTTGTTCCAGCTGATTGCGAGCCCGCCCGATCTGTGTTAGCTGATCTTCGAGCATGCGGATCTGA
CGCTGAGTATTCGCCAGAGTGTTGTCTGCAAAGTCACGATGCGCATTAGTGAAGTGGAAAGTGTTGGAGGACAACCAAGAACGAGTACGTACTCAATCCG
CCGGCGAGTTGCTCGGCATCCGTCTTTTCCCGCGTGGAACGAGCCCAAGCTAGCGTAGCTTCatccttctccttctccagcagttGGATCCTAGGATCAG
GGGCCGAACGGGCTTGGGTCAGCCGATCTAGATCGGCCGTGGCTACAGACAGCTGAGACCGGGTAGCGTCACGTTCGGCGGTGAACTGACGGACCTGATc
ccgagcagcttggagatCTTGGGTGAGACGAGCCAAATCTGCAGAGCTCTGATCAGAGCTGGTAGTGCGTGGGCCCGTTCCGGGATCTGAGCGAACAGAT
CGAGAATTCATGTGCTCGCTGGTAGCGAACTCTTCCTGGGCCCGAGATAACTCGTCGCTGACACGCCGGTAACTCTCAGCGGAAATGCGGACAATATGCT
CGGCGTCCTCAATCTCACGATCTCGGTTACGGATATTTTCATGGAGTTGTTGGATCTCCTCAGCAGCGAAACTGATTTCAGCAACCAGATGGTCAGTTCT
CTGGACACTTTCATCGAGCTCTCGGTGAGCCGGATCCAGCTGATGCTCCAAACCTTGGGTCTCCATGGCCTGATCATGGATCTGCCGCTGGGAGAACGCG
TGTTGACGAGAGGCATCATCCCCCGGGGGTTGGAGACGCCTGGCTTGAGCTAGATTATGCTCCAGATCCTGGATCTCGTTAACCTGATCATGGatctgga
gctcgagctcatcaATCTGGCGCTGGGCGCTGTCATCCAAGAGCCCGGTATGAAGCAAGCTTATATACTGGGCGTCGAGTTGACGCATCTCACCTCGGAG
CTGAAGGTGTCGTTGCTCGAGAACACGAAGGTCTAGAGTAGATCGGAGATAAGACCGATGGGCCTCATCTTGGTTGCGGAGGGCGGCATCGCGGGAAAGT
CGAGCGAGATCCAGGTCGGtctcgagctggcgcacgcGAGATCTGAGCGCACGCACCTCGTGGCGTGGATCTTCCGGAGTCAGAATGGCGAGGTTCGGTG
GATCGAACGGTGGCTGATCCGGTAATCGCTGGCCGCCGGGCGACTTACGATCGAAACCACTCATGGTGAGGCGTGCTAATCTGAAGCGGGGAAGAGGAGA
AGTGCACGAAGTGATACCGCTGGACGGCAACAACTGCGCGCAGGAGGCGATTGTGGTGGAGCAGTTTCTTTTGAACTGCGAGAACGGAAAGTGTGTACGC
GGAGATAAGATCCGCGTGTCNGTGTAAAGCGGCAACCCAGACTGATGACAGACTGAGAAGGTAACCCTGAACGCAGATCCTTGGACGCAAGTTCTTGGAC
GCAGTTCGGGGTTCGTGGCACCTTATCGGTGTCGTTTATCTTCGAGGAGCCTGGATCGATCACCAGTGAGTTGCTGTGGCACAAATAGGCCTTGAGATTG
TTGAGCGTAACGTCCACTTCTTGAACGCACTACCCAATGGCTTGAACGTAGTTCACGCACCAGCCAAAACACACCTCTTTCAGATAACCAATACAATACA
GAGTTATATACACC