Description :
From Genome Similarity Track
Location :
Scaffold_55:3897- 5456
Transcript NameFunction/comments
Physo_350423Amino Acid/Auxin Permease (AAAP) Family

Sequence
1559 bases(100 bases per row)
TCATTCCCACTTTGGCTCAGTTCCGCTCAAGCCGAACGTTTCAGCAACTCAATCAAGCAACTAGACTACATACTGCGCCCGGGTTTCCAGAGCAATGGCG
AAAGGACCTTTCTTCACGGCGGAGGACGCCAAGTCGGCCTTCAACCTCTTCTGCTGCATCTACGGTGTTGGAACGCTTGGTATGCCCGGCAACTTCTCGC
GTGCCGGCCCCTATCTGGCCGTGGTCGCCATGGCCTTCATGGCCTTCGCGAACATTTACTCGTCCCTCACAATGTCCAAGGTCATGCTGCTAGCGCCCAA
GTCCGTCAAGACCTTCGGAGATCTGGGCGAGTGGTGCATGGGCCAAACTGGTCGTTGGCTCTGCGTCATCTCGCAAATGGGCTCGTGCCTACTCATCCCC
TGCGTCTTCCTGGTGCTCGGTGGCTCGTTGCTCGATGGCCTCTTCCCGGAAGCCTTCAGCCAGACCACGTGGATCATCCTCATGGCGCTCATGGTGTTGC
CCGTGTGTCTGGTCCCCACTCTCAAGGAAGGAGCTGCCGCCGCATTCGCTGGATGCCTCGGCACCATCGTTGCCGACGTCCTGGGCGTTGCCGTGGTCAT
GCACGGTCTCAGTGGCCACCCCAGCGTGCCGTCGCCCGACCTCTCCTTCTCGCAGGTCGCCGGCTGCTTTGGCAACTTGTCCCTCGCCTACGGTGCCGGC
ATCGTGATCCCCGACATCCAGCGCCAGCACAGCGACCCCAAGCGTATGCCGCGCGTCGTGGTCGTCACCGTCGGCATTATCTCCATTCTCTTCCTCATCC
TGGCCAGCACGGCGTACTCGGCTGTGGGCTGCCAGATCTCCGGCAACCTGCTCTTCACCATCTACCCCGATTCGGAGACCGGCCTCACCCACTTGGGGTT
CGCTCCGAACTGGGGGACCATCGTGCTCGCCTACCTCTTCATGCAGCTCCACATCACAATCGCCTTCGCCGTGATCATCAACCCGGCGTTCTACATCGCC
GAGCGGCTCTTCTTGGGCATGCACAAGGAAGTGCAGCAGACGCACGAGGACCTCGAGATCGCCACCAACTACCTGCAGACGTCCACCCCAGCCGATCTGG
CCGTGAAGGACTCCGTGCGCAGCTCCAAGATGTCGTACGTGTCTGTGGCTGACGCCGAAAACGTGCACAAGTACGACACCGAGGAGGAGGCGCTGGAGTA
CCGCGGCGCGAACGCCATCAAGTACGTCGTCATGCGTATCGTCATTGTGGTGGTGCTGGTCATCATCTCGATTGTGCTGAAGGACGACTTCACGTCCCTG
GCAGACTTCGTCGGCGCGTCGTGCATCACGGTCAACTGCATCCTGCTGCCTATCGTCTTCTACCTGAAGAAGTCGTGGAGCAACGTGGCCATGTGGGAGA
AGGTGGCGGGCAGTATCGTGGTGGTCATTTGCTTCTCGCTGGGCTGCTACGTGACGTACACCACGGGCAAGGAGCTGTTCGCTCCATCCGACGACGAGGT
GGAGTTCCCGTACTGCGCGCCTGAGTTCGAGCACACGGTGTACTACAACGTCAGCGCCG