Description :
From Genome Similarity Track
Location :
Scaffold_204:38966- 43970
Transcript NameFunction/comments
Hyaar_Emoy2812540PREDICTED: dnaJ homolog subfamily C member 13
Hyaar_Emoy2812541conserved unknown protein
Hyaar_Emoy2812542Equilibrative Nucleoside Transporter (ENT) Family

Sequence
5004 bases(100 bases per row)
TTGATGCATTAGAGGATTCTGGCGGCGAAAGCTCAGTCGCGTCGAGCCACTCTAATTCCCTGACTGACGTACACCCTGATGACGATAGCGTGCAGCTCGA
AGAAGAACCTAGGCGCGTGACAGTTGTGGCAGAGCATTGCGGCGCGATGAGTAGTTCAATGATTATGCAGACCTGCTTAAGCGTTCTTAGTCGTCTCGTT
GATTGCCATACAGCAGAAGAAGAAGGTTATATGTACCAAGATGTGCGTTTCCCTAAGTATGGGCGGCTGACGCATTTTGAGGGCTCGAGTGTTAGCCCGA
TCAGCTCAATCAAGCAGCGGCTGTGCGAAGACCAGACGCTGCGGTTCTTGGTAGGTCTTTTGGATTGTCCGAATCGCATTGTTTTTAAAAAATGCCTTGG
CTTGATTCGGCTTCTGGTTCGGCACAACGAAGCGATCATCCCGAATCTTCACGCATCTGGCATCTTTTACTATCTTCTTCGGTTTGCCCAAGATGTGGAC
GAAATGTCGATCGCGGCACGCCTTATCTCTCATATTCATTTGCGGCAATCCGGGCTTGAATTTCCGCATCTCGTCGATGACAAACAAAAAGGAGAGAACA
AGAAAGGTATCTTTGCCCCTGATCCGCTGACTCGTATCTGCTTGAGAAGTTGGTTAGTACGGGTGTTGCCCGTGTCTATGGTTGCTCAATTGTTGCGTCA
CGGCCCACGACGATTTGCTACAGCACTTTTTTCTGACGCAAACAATCCCGAAGTGGTTTGGAACGCCAATATGCGCAACCAAATGGTGGCTTATGTTGAA
AAGTTCATGAATTTACATACTGACGAAAGCGGGATGTTCTATATTTCAAAGAATGAAGGATCCGAGCACAAGGCCTGTATTCCGTTGATCAAGTACCCGA
AGGAAGTCCATGCACTACAGTGCTATCAGTACTACTTACACAACCTTCTTGACGAAAAGAACTTTCCTGGATGGCCTATTAATGACGAAGCTGCTTTTCT
GCGTGCTCTTCTTGACTCCATTCGCCGTTGGGTACACCCTGGATCGTTGCCAAGTACTCGTGGGGCTGTCAACGATCAATCGACAAAACTTCTCTCGGTG
TTTGATGCTGTCGAGTTGCTTGACGCTACTGCCTTGTTGGTACGCCGATTTCCTGACTCCCCAAATATCACTAACTTGCACAATATCTCGTATTTTCTGG
AGGCTTTGGAGCGGTGCATTACAGAACTAAAAGCCAATCGTGTTGGCCGGACAAAACCATTTTTTGACGTGTCGAAAGCCATTGCGGCCAAGACCGCGTT
CGTCAAGGCATTCAGTAGTGCGATTCGCGTGATTAATTTGGCCGTTGCTGCTTCGGATGAGAATGCCCGCGGGGGCAGTTCTGGACTGGGCCTTCGCGTG
CTGTGCAATTCCCTTCAATTATTATTTCACAACCAAGGAGCATTGAATGCTGTGGATGGGTGTGCACCGAACGTGATCACACACTGGGTATTGGAAGCGC
TTGTGAACGTTCTTAACCAGCCGAACGGACGCGTGTCGGCTGCCGCGCAGTCGATCGATCTGTTGCCTTGTTTGACTCGTTATCTTTCACAAGAAGGTGA
TCGCTTGGCCACCGACCTGTCTCTTCAAATAATGTACGAAATGGCTGGCAGCTCGGGAGAAATGGCTGAAGTCCTCTTGTTGCAGCTTGCTGAGCACGGA
ATTGTATGGTATTTAACACTGCTGCTGTTCCACTACCGGCCAAACAACGATGGCAACAATGGTGAATTACAGCGTATTAGCATTGGTGCAGCGAAGGCGT
TGGGTCGGATCTTAGAAGCTAACGCAAAAGAGGACTCGATTGCTGTGTTTGTCAAGCGAATGCAGACTACAATCGAGCAGATTTTCACGCGTCCGCTTGT
AGACATATTACGGCGGGCCGGTCCAATTAAAATACTGGACGTGTTAGTCACTGAGGTTCGCGAGCCGCACGTCATGTGGACTGACCGCATGCGGAAAGAA
TTGATCAGCCTTGCACGGCGAGCAATACAGTTTCATACGACGATAGATCAGAGCGATGGGGAAGCGCACAAAGTGTTTGAGCTGCCGTCCCACTTTAAGT
ACTCGGCCCAAAAGGAAGAGCTCTGCGTGGCTGGCATCTACGTCAATTTCTTTAACGAAAACCCGAAGAATGGTATTCTCGCCCAAATTGCTGGCACTGA
GAACAGTGGCGGCAGGCGTGCTGAAATGCTCAAGCAGAAACCAGGTACCAAGAAAGAAATTCAAGCTGCTGCCGCGGCGGCTGCTGAGCTGGAGAATCGC
AATGTAAGTGGACATGTGATGCACGGTCTGTTGGCAGCGCTGTCATACGACATATCAGGCGTCCGCTCACAACCGCAAGCACTAGAGAGTGTGTTACTCC
AGCGGTTGCTGCCAGTTGCTACGGCTATAAGAAATCTTCTGCAGTATACGCCTGACATGGATGTACAGGTTGTACAGGCAGACGGTCTGGTGACGCTTTT
GTATGTTCTGGACCACGAGACGCAGCCTCAAGGGTACTCGTTTGCGAATGCACCACTTTTGCTGCTCCGTTGCATGGAGTGTGTGCACACGTTGTCATTC
AGTGGCAAATGCGTTGATCCGTTGGCAAAAGCAGTTCCACCGTTCATCAAGAGTGCGTTCCAGGTCGTATACAAGAACTTGGCGCGCACGGAGGCTTCGA
CTGAGGGTCAACTAGCTCGCATAACGTTGCAGCTGCTTGGCAACTTGTGCCTCATCCCTGCTTGCATCGACAATCTCGTAAAAGGAATGGACCCTGTTAG
TCTATCGAACCTGTTGCCGCACGTATGGCTGGGAGACTCGACGGAAATGCAGCTTCTGTTGTGTTTGCACATGATCCCGCTGAAGCGACATACACAAGCC
GCTACGGAGTTTGCGAAGGCTGCCGTGAGTTCACAGCTTGCAGCAGCGCTGCTTAACCTGCTTTCCACGCTCATGCCTAAATCGAAGGTGGGAGAGAGCA
CAGCAACTAAGCAGTACGCCGCACGATTTCTATCAGTGCTGTCATCCAACCCAGGCAGCGGCGGCGCCATCTCGAGTTTGCTTATCGCTTCTCGGGTCTG
GGAAACCCATGGCGATACTACTCAAGCCACTTCTGAAGACCTTCGCCGTTTGCTTATGCCTCCATACGCGCCTGCATTGCTCAAGGCGCCTCACGCAAAT
CCCAACAAAGTCGGCTAGGATATGGGACGCGCGACCGATCTTTATTCTCTAATGTGGTAGACAAAACCAACTGCCCCGAAATGTCAACACAGCTTGCTGA
TCACCTTGTCGTCTACTTTGTTTCGTCGGGTCCTAGCTCAGCATCAAAGAGGTCCAGAATCTCGTTCTGAACCTCAACCGCCTTGTCCTCGTTTCCGCTC
GAGCGATAGGCCTCTGCCAGATTATGACGTGCCATGATCGTTTCATTGTGCGCCGTGCCAAGCACCTGCTTCCGCACACTCAGTACCTCTTTGTACAGCT
TGATTGCGTCGTCATATTCACGTGCCTCTTTTCTGGCGTACGCGAGATTGTTCTTCACCAAAGCCGTGAGTACACTCTCCGGTCCCGTCTTCCGTTCCAG
CATCTCGACAGCTTCCGCCAGCACTGCAAAAGCCTTGTCCGGCTGTTTGTTCTGCCAGTAGAGCACGCCCAGGTTGCTCAGACTGAGAGCAATATCCGGA
TGCCCTGGCTCAAGAATCTCTCGGCGGATCTTGAGCGACTCTTGGATGCAATCAAGCGCCCGGTGCAGTGCAGTCACCCGATCAAGACTGGAACTCGCTA
GCGCGAGAGCACGATAAACAAGGCCCAAGTTGTAGAGCGTCGTGGCAAACGACGCGTGCTGCTCCCCCACCGTGGCCTTGTATGTCTGCAATGCAAACTC
GTAGGCCTCAACGGCCTCGTCCAGCTGGCCCATATTTTTGTGCATGAGCGCAATATTGGTCACGGTGCTGGCATAGACGGCGTGGTTCTCTCCAAAGTGC
GACTTGACCAGGTCTCGGCATTCCAGTCCAGCGTCCAGAGCAGTTTGGTAAGCTCCTGCGCTGTTTATTTTGCGCACGTATAGAAATGTCCGTCAAAGTA
CGAATGTGAGCATTAGAATTTAGAAAAAAACGCGTCGACATGAAAAAGTGACCAAAACGGTACAAGCGACGTTGTACAACGCCTTTTTGGGTACAATCAT
TGCGAGACACGGGTACACGACGTACTGGTAAGCCGTGCGGATCTCGCGCTGTAACGCGGCAATGTCCTGCTCCACCTGCACGTAACTCGTGTGCGGCTTC
GTGTGCACCACTTCCACCGTGTTGCGCTCCGTGTCCTTCACCGAAAAGAACGCTAGTGCAAGTGGCGGTCGAAGAAAAGAAGCATGATGACGCCGCGTCG
CCACCACCACATAACGCGTTAACATGGTTTCGCAGTCGCCACGTATAGAAATCACGGATAGAAACTCGTCAGAAACACCCACATACACCCATAAATACCC
ACTCCCAAGCGATTAAAACACACACACACACGCACACCCATCCACCCGACCCAATAAACCTCAAGAGCTCATTAAACCGTCCAACCCTCCCTGAAAGTCC
GACGCAACTTCATCTGCCATTCCAACCACAAAGCGGTATATCTCATCATGTTCCAGCTACTTACACACAGTCGTCAGGACATGCGGGTGCTAACCCAATG
GCCACGCAATCGCTATTTACAATGCGCCCGCACTCGCCTCTGGTCTACCACTACAAAACCTACCTCCCGACCACCAACGAAACAGATGGTTCTGACCGAG
TTACGCGCTGTCGGTCAACTCGTCGGTGGTGGTCTCATTGTGGTTACGGCGCTTTTGGCATCAAGTGGCTTTTTGATTGAAACGGTCAAGAAACTCAACC
CCTTACCACCTCCAGGTCTGCTGCTCCAGATCAATGGACGGGACGGAATTGTGAGCGACGTCCACGTGCAGCGTCGAGGCAGTGGAGACGTGACGGTTCT
TTTT