Description :
From Genome Similarity Track
Location :
Scaffold_10:38960- 40223
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_10-snap-gene-0.24Dynein heavy chain

Sequence
1263 bases(100 bases per row)
TCGGGAAGCTGCGCCAACATGCCGTCGAGCAGTCGGCACAGTGTGGAGACGACCGCAATCGCAGGCAGCGGCACAATTGGTGCAAGCTTGTGCTCCTTCA
TCATGGCAAACAGGCTATCAATGTACTTGCGAAACAGCGACGCCAGCACAGCCTTCTCATCTTCCTTCCCGTGTCGGCGTGCGACCCACGACTCTGCGAA
CGGCAGCCAGCCAATGTCCCCTTCACTCACGTAGATGATTCCAGCGCGAGAGACTGTCGCCGGCGTCGCGTTCTGCAGCGAATGCACTTCAAACATCATG
CGCATCGACTTGGTGAGCGGGATCCGCTCGTTCGACACGAGCGTCAAGACCTTGTTGTCGTCCATGACGGTGTTCATCGACTCGATCCAGACCGCGTCAA
TGTCGCCGTCGAGCACGATCCACTTGTACTGCTGCGCGTCGCTGAACGGCGCCATGCCCTTGGACATGTTGCGCATGATAGACGACAGCACGCCATCCTT
CCAGTCATTGTCGAGCGTCATGAAACCGTACAGCTCGTCGGCGGTGAGTGACTTGGGGTTGACGCTCTCAAAGACTGTTGAGGCCTTAGCGAGTCCGTGA
TTGTGGCACGATGCAAGCGTCGACCAGATAGTGGATTTGCCGCACCCGGCTGGGCCAATGAGCATGACGCTGTGGCGGACGCGGAGTACGTCCTCCAGCT
CTAGTACTTTCTTCACAAAGCAGTCCTCGGGTTGCAGCTTTTGAGAGGCGCAGACAGCGACGCACGCGTCTCGCAGCGAGTCGTTGGCCATGCGCGGCAG
CGTTTGGCCCGGAAACAGGTCGTTCAAGAGGCCAAGAAAGACGGGGTAATCGGCAGGCAAGAGCCGTGGTGTGTTGAAGTCGCGGAGCACTTGCATGAGC
ACGTTGTCTTCACTCGCTTGGGTGCCCCCGGCACGACGCAGAAGTGAGCCGGCGACCAAGAGCACCGACTTCACTGCACGTAGCCCCCAGTCGTAGTGTG
TCTGCTTGGACAGCATCTCGCAGCTGAGATCGTAAAGCGTCACAAACTTGACCGAGAGCACGCGCGCCTTGAGGAAGCCTTCGGCCATGAGCATGTTTTC
GCAGATGGGCTGCAAGTCCGGCTTGATCATCGCACACGATCGGAAAAGTGCCTTCAGGTTCTCTGGCAACTCGGCGCGGCCCGCATATCCTGGATTCATC
GTAATAAACAGTCCGACCGTCGGGCTCAGCGCAATCGTCTTGCCGAAAAAATCGCATGATCCC