Description :
From Genome Similarity Track
Location :
contig_42:38955- 39977
Transcript NameFunction/comments
g9457.t1hypothetical protein

Sequence
1022 bases(100 bases per row)
CCGTCTCGTCCTCCTTGGGTGCGTCACGTACAATAGCGCATCGTCGGCAAATGAGGTCTCCGCACAGTCTGCAGTGGTGGCGACGTCGAGTCGGCCCGAA
CTTGCGCGAGCACACGCTGCAGCTCTTGCGAGAGCCCGACTTGGCCCAGCTGTCCCGTTTCACGACGCCCTGCATCAAAATCCGTCGCGAGTCCACGAAG
ACCGCCATGTTCATAAGAATGTTCATCATGCGCTTGTAGTAGTTGGCGGTCACCGCGAGTCCGTTGAAGTTGTTTTGCGACAGCATGAAGAATTCGGTCA
CGTTCGGCTCGCGGTCGGCAGGTCGAGAGATCCAGATCGTGTTGAGCCGAATGCGCTTGGTTTTGAGCTTTTTAGGCAGGTCGGGGCACTCCGGGATATC
AAGCGGCAGCGTGACGCGTACACCCACGTCGCGTCCGCGTAGGTCCTTCGTGTAGATGAGGTACTCCATGTAGCAGTTGTCGCGCTTCTTCACGAGCGGC
GACGGGCTCAAACAGGTCCATTTGATGCCCATATACAAACACTTTTTCTTGGACGCCACCGTGTGGATGTTCTTGAGCACGGCCGCGTCTGTAGCGTAGC
CAAACATGAACTGGTTCCACGCGAAGAGCTCCGCCGACGTCTCGGCATAGAAGAAGTCGATGAAGTGGCGGTAGTCGCCGTTGATGCGGCCGAAGATGCG
CGCCTGGCTCGCCGTGGGGCTGTCGGGCGTCTCCTTCTTGATGGTAGTGAGACCTTCCACTTTACTGACGGCAGTCCACGGCGCGCGGTAGACCGGGTTC
AAGCCTTTGGCCTCGTGCAGCTCGTACTCGGCCAGCGCGTTCTTAACGATCTCCTGCATCTGCTTCTCGTAGTTCTTGGTCTCCTTGGACGTCAAGTGGA
TCTCCGGGAAATAGTCGTCCGGCAAAGGGAACTGGCCGCCGTTGTCGTGCATGGTTTCGCTGGAGTCTCTGGAATTGGAGGCAAACAAACGAAATGTCAA
ATGCTGCGTCGGACACGACGAT