Description :
From Genome Similarity Track
Location :
Scaffold_25:389534- 400151
Transcript NameFunction/comments
Phyra_94850phosphatidylinositol kinase (PIK-L4)
Phyra_77597phosphatidylinositol kinase (PIK-L4)
Phyra_77598conserved unknown protein
Phyra_45595eukaryotic translation initiation factor 1b, putative

Sequence
10617 bases(100 bases per row)
TGATCCATTCGTCTACAAAAATGGCATCCAGCCGATGTACATTTGGGCGAGGTTCTCGTGCGATGTGGCCTCGTGGATGAGCTTGTCCACTTGGCCTTGC
ACTGAAAGTGGGAGTGTCTCGTTTTCGGGCAGGATGCTGCGATGGGAGGACGACACGAGCGGGCGGATAGCGTCGCCCAGGTTGTAGATGCCACGCAGTC
GGTCGTCGATGGTCGTGAGCACAAGGCGCGTCTCTGCTTTGCTGCGCTCGCTCGAGATTTCGATACTTTTTTTGGTCGAGCCACTGCTGCTTTGAATCGC
CTTGCCACGGCGGCCCCACTCGACCAACGGATCGTGGATGAACGACTCGAGCACGCTTCGCAGCGTCTCGCTGTTTTCTCGAAGCAGATGTATCGTTACC
TCGCTGACCCGACGGAATACTCCTTCATAACCTGTGATTCCGAAAGCGTCAATAATGTTGGGCGTCAGACGGAATGGAACGATCTCGGGCTTTGCTAACT
TGAGTCCCTTATCGAAAAGGCAGTCGAAATCCACGTGCACGCACTCGCCAGTGGTGCAGTCGATCAAAATGTTTTCACCGTGACGGTCACCTAGACCGAC
AATGTGCCCCACCATAGACCACACGGCTGCCGACCGCGAGAATGCGAGCCGAGCCTCAAACCAGGCCGTCGGGTCGGCGAAATTATTATAAAACCACTGG
TGAAACCTCGGAGTGAACATTGGGTGCGAAAGCACCTCGCGGCGGTAGTACCGCGCCATCGCTGACGGATCTTGCGCGTACTTCTTTTGCATGTCGAGAA
ATTTCTCTTTGATATGTGTCAACCGAACAGGCTGTATGTAGCCACGCTCGGTTTTGTGGATCTGACCGATAAGCTGCCGCATAGCCTTTGTATTCCGTAC
CCACTCCATCAATCCGCTCTCCTCGTTTAGACACACCACCGCGTACGTGCGCAATCGGAGCTTGCGCTTCCGGCCTTCTCGATCTTTCTGAAGAAGTTTG
TTGATCATCGAGTTGAACTCCATCATGCGTGCATCCTTCCGAAGATCACCAGTCTTCTCGCGCTTACACAGAAACGGATACATTTGGCCATCGGTGCCCA
ATACTTCGATGCGTTTGGGCTTTTCCTTCGTCATCATCACATCAGCTTTATCACTAAATGCCTTGATGTAAACTTGAGCGTTCGATGAGAAGGCGACATG
GAGTTCATCACGAGGGGCAAGCCCCGATGCCGGCCGGATCGTAGTCAATGCCGCCTGGATTGGTACGAGAATTTTGGTTCGAATCCGGCTCAGTCGAATG
TGGATCTTGCGCTGATTATTACCGGGGTCGTGGCCAGCGAGACTAATAAGTTCTTCAGCCATTCGCATTCCCTCCGAGAAGCTGTCTGCAATCTCCTTAA
GACCGTTCGAAATTAACTGCTGCTGTGTGCTGGAGATGATTTCACGTGCACGACTTTTTCGCTGGCTATTCAATGATCGCGAGAGACCCAGTAGTGGCCA
CATAGCCTGTGTAGGGTAAGCCAGGAGCACCCGAATCATGATTTTCTTGACGCCGTCCACGACAACTGGGTTGGGGTGGCAAATGCGAGATATCACCTGT
GGGAAGCACACAAACCACTCATACGCCGGCAATGACTCGGTGGCTTCATCTACCACCTTGCCGATATCAGCCAGAATGTTCTGTTCAGGGCTGGGCTGGC
TCAGATGGTTCTCAATTTGCTGCATGGTCTTGTTTACTTTGTTGCTTGTTCGCCCACTGGAAGAACTGGCGTAAAGTACCTCGCCATACTCGAACCATAG
CGTCAGCAGTCGGGGAAGTGACTGGAATACAAACTTTGTTCCGTGTGTCAGCGCTTGCACATAGTTTTTCATCAAATTAATCAGGTGCGCATGAAATACC
GAATCTAGTGCAAGATCGGCAGCCTCGTCAGTGCTCACAGACCCACTTAAAGCATCGGGGTGGCGTACACTCAGCAAGTACTCGTAGTATTTAGCCAGAA
AAAAGTAACCTTTCTCCCACGTGGGATCGAAGTGAATGACAGCTTGATACCGCTCGATCACCTTTTTGCCTTGACGCTGGCCAGACTCTTGCATCCAGTT
GGTCGCCAACAGTAGGTTCTTCGCGCTTAAATGAGGGTCTTCAACGTCAAAGTCCAACGTAGATGCATCAATATCAACTGGCTCGAGAATTTGCAAAGCC
TCGTACATTCGGTCCTGGCTCACCAGCAGCTTGGCTTTTTCAATCAGTGCGTACTGGTTGTCCACTGCTTCAGCATGCATCAACGCGCTGGTGGCGGTGC
GAATAAACCCTTCTTTTCTAGCTAACTTCGCGTACAGAAGCCAGTTCTCGGATACTTCATTTCGTAGGTCTGCCTCATGCAGAATTACTCGGCGAAGTGC
GAGTATCGGATCACGGTATTTGAGCGGTGTTGCGATGGCATCATACCGCATTTTCCAAGGCGTTTGCTTTTTCCACAGAAGACTGCGCTGCCCTAGTTCG
TCATACTCCTTCATATTTTTTAGAAATATAAATCCCTGTTCAGCCTCGTGCAGGAAGTGGAGCTGATGAAGAAATGGATACGCGCGTTGGTATGATTCTG
CGGACGCCGCGGCGAGTGGTGCCATCACTTCCAGTCGTGCTGCTTCCAGGTGGCGTTGGAAATCATCTTGCTTTCCGCTATGTAAACTGTGGAGAACGCG
CACGAGCATCAGTTGTGAGACAGCGAAACCCTTCAGCCGCCCCCCATCAGACGAACTGGTCGACGAAACAAGTAGCGGATTCTGTTTCTCCGCACTCAGC
AGATCTGTAAGAAGCTCCCATCGTGACAGGCGCCAAGAGCATTCAAGCGCAAAAGGGTACATCGTCGCCATGAATTGAGGTTCTTGTGTAACAATCCCGT
TGATGTGCTGCAACGCGCTTTCAAGTCGCCCTAGCTGGATGAGACAGCCAATCATTCCAGAATAGAGCTTAGGCTTCAGCGTATCTGGGTCCTTGTGTGC
GTTTGCTTCCAACATCTCCGCAGGAGGCTGCAGCATCACATGCTGGCTAAAAGACAGTCGAGTCGGTCTAGACGATAGAGCAGACTGGATTTCTTGGATA
GCTTGTTCGTAGCAAGCTAGCGCATCTTCCCACTGAGCAAGCTGCTCGTGATCAATAATCTGATGCATCAAATCAGTGAGGTTCAGCCCCTCCTCTTGGT
CCTCGCCGTGCAGACCCCCTCCACTATCATTGCGCCGGTACGTGTCGTATAAGCGGCGCAGTGTTGTCAACCCGATAAGTGCGTCCGGTTCGTCCACGCT
CTTATATAACTGCTGGAGATAAAACGCATTATTTGATATCAAAGACAGGTGGACCGGTCCCGCCATATCAATATTGCTGTCTCTTGACTCCGTAGGTGTA
AACTCTTGCTGTCGCAGATAAACTTCAAAATATTGGATAGCTCGGGCGTATGCCTTGATTTGGTATGCAGCGTTTGAAAGCGAGCGACTCGGAATGTCTT
TTAAAAACTCCTCCAGATACTCCTTTTCGTGGTCATCCATTTCGGAGGGCATGTCTGAACGGCCAGAAGCTGATGTCTGGCGGCTGGCAGTGCTGCCACT
GAGTGCGAGGCGCTTTTTCTCGCTGGTCCAAATCCATTCATTCAGTTCATCGATTGTCGAGAAAATGGTCTGGGAGCACTGGTCATGGCGACGAAAATAT
TCTCCAACAGCATTTTCAGACGTGCTGCCGACACTAGTCACTGAGTCACTTGTGTGCTCAGATTCAGGCGGTGGTATTAGGATATCATCCATTAAAATAC
CGCAGTCCTGGTCATTCAACACCGCCATAACCTCTTTTTTAAGCTCCTCGCCAACGTCAGGCCTTCCAGACCGAAGCACATTCTGTATCAAATACGGCAA
CAAAAATCGGGATATTTTGGGGCACGTCACGAGGGCAGTCCTACACGCCCAAAAGATCTTCCGCTCTGGCGGCTGAGAAAGGTGAATCAATCGCCGACAC
CACATCAGCAGCCATTCCTCATATGACGTTCCATACGTTTCATAAAACGAAATATCATCGCATGCAGGGTGCAAGTTTCGGTCAGCACTTGCTGATAAAC
GACGGTCGGATCCACTATTATCGTGACGTGAAGATTTACCGCCCGACAAAGAATAGTTTGTTGACCAATATGGCTCAACGAACTGAAGGACATCTTTCCG
CTCAAATCGTCTTTTCATCCATTCGGGCATGGGAGACCCGGGGCCCTTCCTCGTTTTATAAGACGACCCAAACGTAGTTGTTGATGCCAAGCTTTGGCCA
CTATGTTGTGGATCGGCTGTCAGCTCCCCCAAAAACTTCAGAAGCTCCTGAATTGCAAAAGCTAACGAGTCAGTGTTCTCGGGTGCTGCACGTAGTTCCT
TCAGCAACCATGTCTCTATCAGCGCACAGGCTAAGTCCTTAGTCGAATGTTCAATCTTTTGGTTCACCTTTTCTTTCCCGACAGCAGCAGTTCCTTGCGG
ACCAGCTGCCGTATAAAACATGCTTAATGGCACGCGGGCGCCATCGATTGCACCCAAGGCTCCCAAGCATCGTGCGCAAAGCAATTTTATAGGCTCATGG
CTCTCCGTTCGTGAAAGCTGTAAAACAGACAGCACGACACTAGCAAGCGCTGGATCGACGTATATATCTCCTTCATTCTGCATCAGGGCTTCTAACTCAG
ACCCACGGACAATCAAGCATCGTAACAGTTGTGTCAACGCCATTTCACGAACCGCCATGTCAAGATGATTGACGTAGGCTGAAAGGTTCATCAGGTATTC
ATGTAATGGTCGGCATCTTGGATCGCCGTCATCCGCGTACAAGACAACGTAGATCTCATCGAGTTCGGGAATGGACGGTAGCAACGGAATCTTCGGGAAC
GCTGGCTTCAGTTCAGCTCTCTTTTCGATGAACAAGTACTTGAGGACTTCCACAGCTGCTGCAATGCATTTTGTTTGAGCGTCATCTCTGCCTGAAGGTC
CGACTAGACCAGGGTCACCATTTTTCAGATGGTCGAGAGCCTCAACATTCCAGCATTGACTAGCATTCATGGATCTGTCCTCAAGCAAAATGGCCGAGGA
TTCGTATCCAAAACACGGAAGCAGACTGACAATGATAGAGCTTAAATTCGCCTCCAGAGCTTTCGTTGACATCATTCGCAAGAAATTTCCCCATGCTTGA
ATTGCATGCACTTGCAGTTCACGTTCTGTGAGACCGACCTTTAGAGTAGCCATCACTTTAGGAACAAAAGGATCAACGACCCCGTTACTCGGCGTACTCT
CAGAATATGCCGATCCACAATTATAAAGTTCCAGTAATCGGTCAATGCTTTTTATGGCCCGTATCTTCAATTCAACGACGGTGTTATCGCTGATGCGATT
GCCTAAATCCGTCATGATGCCCAAAAAGTAAGGCCGAGGCATAAACCCCTCTCCAAGTTGTAAACTTGTCATTCGTTCACTCGTCTCCACACCCCGAGAA
ACTTCATTTAAGCAATTTGCCACCTCTCGTATCGCTCTCTTAGCCATACGATACTGTGAGCCGCCAAGCTCCCAAGCTAACAAGTTCATCAACCGCAGCG
GGGAATGTGTAATTACATCACGGACAGTCAAATTTTCTGGCAAGAACTTAAACAAAAATTCCCATTCTGCCAAACGATTATTGTTTGAGACTGCCTGTAC
CTGGTGAATAAGAAGGTCCTTCAGCACATACTCGAGATGATTCAAGAGAAGATTAGCAATAGTCATCGGTTGCCTCCCTTCTGAACCATTGTCAGCCATT
ACAACATCTTCCACTGTGCCGTTGTATTCATCAACGTACGCGCGCAACATCCGTTCGTTTTGATTGAGCACAAACTTCGGAAGCACGTATGGGGCACCGG
CTTTCAAAAACATTTTTGCGTCAACTTTGCCCTCCATGAATGTGCGGAGAAACAACTTAAGTGCCTGAGTCTCTAGCAACTCGTCAACAAGCGGAAAGTA
GAGCAACTCGGGAAATTCGACGCATGATCGTCTCCATGACATCCGGTGGTGAGCCATAATGCGGCAAATCTGGTCGTAAGCAGTCGCTGCATATTTCAAG
CGATTCGCAATCTGGAACCGGTTCCACAAAGAGACCAAACGCAGGAGAATCCACGCGCAATTATCTCCGCGGTCACCTTGCTGCAAGTCACACTCACAAC
CAATGGTACCCGCCGTCAACATTGTAGCCATGATCACACTATCATCAGAGCTTTCTGCTGCTGCAGTCAAAAGAGCCTCCAGTCGCTCCATCAGACCAAC
AGAACCATCCTTTGCTGGATCAATCATTGCATCGAGAAGTCGTGGGTGCTGGACAATGGACTCCAGAATGGCTTGACGGATAAGCCCCGAGGGACTTTCA
AAACCATTCAAAAGGAGCTCGACAAATCGCATGCCGGTTGGATCTCTTCCCAAATCAACCTCACAATGTTCAAAAATGCTGGACATCGCGTAGATTTTTA
CGACACGCACGATTTCGGTAGTACTGACCGTAGCATCGCAAATTATGGGCTCGAACAGAGCTAGTGGAATGGGCAGCAAATCGAAACTGTTTGCACTGTT
TCGGCATTGGCAGCTCTTAGGGCGGCAATTTCCAGCGCAAACTTCCCCCTTGTTGAGATGATTCACGACACCAACAGATGCTTGGCCGTACGCCACTGCA
CATAACACTGCTCCACACGTTTGAATTATTGCTGACGAAATTAATACCGACCCCGTGCGTTGGATCTTGTCGCTGAGAGCTTCTACGATGCAGGTGACCA
TCTTTTTCGGCGAAGTGAGCGACCCACAAACGACAAAAAACGCTAGAAGGGGGAGCATAGCAAGATAGGAACACACTGCCGTATCAAGTAACGTATCCTG
CAATATTGCCTGATAGGCAACTTTCCAGGGAAGAGCATTCCGCCAAAAATCCTCACCGGCGACATTAAGCGTCGTCGGACGTGACCACACCAAGTATACC
AACATTGGACCGCGTAGGGCTGCAGGTTTCTGGAAAAGAGCATCAAGCACAATGTCTCCGCTACGAACGCAATCGTACGAGACTTCAACTAGCCTCTCTG
ATGGAGGTATGTCGTGACAACCCGGGTGCTGCTGGTACAGTTTTAAGAAGTCGACATACTCCCAACAATCAGGTGTTACAAAGGTTTTGTCCCGTTCAAT
ACTTTGTGCAAGTATCTGTTGGGTCTCGACGGTCTCAATGACCTTGGTTAATAGATTTCGGTATTTTTCCAGCTCGTGGTCATCAAAATAGCGAAGCAAG
GTTAGCCATAGATCCAAGTAATCGGATGTAAGCGCCGTAAGCGAGGGTGCATACGTGTTCACAACCAAATCCACACGCTGAAACAGTGCTCGGAATATGG
CAAAACTTTCTAGGCGCACAAAGGCCACAATGTAGCGACGAAGAGGTAAGATGATCCGTAAGCTAGTCGAAATGGCAACAACATTTCTACGGTCTGTGCC
ACTTCCGATCGAGATTAGATCGAGCACCCACCGACTCAACTTTTCATGAAGCTCACCATTGTTCTGGCGGTGCCAGCCAGACGACGGTCTTTGCTCATCC
ACAGATATTTCACTTCGCTTTCGCTTGCGAGCTATTTTGCTTGATCGAGTTGAATTGGACCCGCTGTTCGCCAGCGACTTCGAAATGAGGCGAACCACCT
TTATCAACACTTCCTTCGATGACAGCACACGATGAACACCATCAATGATGCTCGATCGAAATGATGGGCTCAACACTCTAATGTCGATGATCTTCAATAA
ATCCACAAACAATGATGAGGGGGACGAGATATTGGATTGGCGAATGTATACACACAACACCGAAAGCACCGACTTCCAAATCATTTCCGCACTAGTTTTG
CTTTCACGGCCAGCAACGTGAACTAAATGCATGTTCCCAGATACCCATGTCTCGAACGGCGGCCAGAGTACATCCGTAGCAAACGTAGAGAGGCGCGGAT
AAGCTTCCCCAATCAGTTCAAGAATCGCAGCGCTCGCTTTAAGTATCCGAGGATTAGTTTTATGAATCAAGCTGGACTTCAAGTACATCAGCGTCAGGCG
AACAAACCGCCTTTCCGAAGGTACGCTGATCTTCAACATCGTGTGAAGCAGTCGAAACGTACTTTGTATGACTTCATCGACGCTTTGACTGGAAACAGCC
CCGGTCACGTATGTTTCCCCAGCGCTTTTCACAAGCGTTTCATTCTTGACAATGAACAATTCCACTAATTGGCATAACCTGTCAAAAGATTGATCCTCTT
CAACCATCGCATGATGCTCACGGGCAATTCGGTCCGCTAGCACAACCACCGACTGCCGGAGAGTCACAACCATGCCGTACGAGCCAACTTGAATCGAAGG
CAGCATCTGCTTCAGCTGCTCTCTACGTTCGTAAAGATGGCTCGAATCCGTAATCGGCATACATCCACATAGCGTAGCAGTACTTTTCGCTCCCAGCGGT
CCATCAGCATCTTGGTACACATGGATCGCCGTATCCAAGTAGCACATGATGTTCGCTCCTCCAGGCAGCAGATCCGTCGCTTCTCTGTTTTTAAGCGACT
CCTCCAGCAAGAAACAGTCCTCCAGTAGCAGCACGGTGTCTCGAAAGAAGTGGATGAACCCGTACACGTCGTTTCTCTGGAGGAACAAAATCATCTGCAG
CGTTACGCCGCGAATCTCTCTCTGGGCCTGTCGCAGCCTCTCGTTCGTGTAGAACGACACCATGTAGAACAGCATCGTGGCCAGCGTCGGGTAGGTCGGG
AAGCCTGACGCCGAGGGGTCGTCGGCAGCGCGTGAAGCGCCCGTGTTGCTCTCCATGAAGAGCGTCATGGAGTGCGGACACGCGCTACCGCCCAGCAGCA
GCGCTAGAAGCTGACACAGATCCTGCAGCACTAGCACTGCCTTCTCCGTCGCCAGCGTCGCCACTGGGCGCATGAGCTTGGGCAGCAGCTTCCGCAGCTT
GGTTAGTATAGTCTTGCAGCGGCGGATGGCCGCAGGTGAGCCCGAGTCGTACGCGCGGTCGTCATGCTGCCGCTGGTGCGCACGAACGTGCCGCAGTAGA
CTGCCTACATCGCTCTTCTCCGCGTCCTCGACCAGCGGCGGCGCCATCCCGAGCGTCGTCATGGCAAGTGGTGGCGAGTGCAGAAGACAAACACTCCCAC
TTCAACGTACTTAAGTGGATTGTACGTGGTGCGTTGTACATAGGTTGCGCGGTGATCGCACTAAGTGCGCCCTCAACGCTTGGCAACCGCACGCTCAATC
GAAGATGGCGACCAAGGGTGTGTGGCAGCTCAAGCAGGTGACAATCCGTTACTGCCAGCACGGCGGCAGCAGTCGCCACGTGCGACAGCTCCTGGGCGAC
GAGCGCTTCCTCAAGTTCGTGGAGGCGAACCCGCAGGTGCAGTTCGAGACGGAGCTCAAGGGCGCGCGCCACCCCGTCCTCATCGGCGACTACGGTGCGT
AGCGGGCACTGAAAATTGCGGTTATGGATTGCAAATGGAGGTGCTTAAATGACGTTTTGGCTGCCTAATTCCAGTGACAAATGAGCGCAAGGTCAGCGAC
ATCAAGAACCAGGACATCCCCTTCATCCTGGACCAGGTGCGGCTCACAAGCGATTGACACACAACGCAATACTGTCTGGACTGGTTGTCAGCGTTGCTCC
CTACGGCTACTTTGCTAACGGCTACATGTGATTATGGTGGCGGGCAATTCTTCTGCAGCTGGAGCGTCTTCGTAATTCTAGCGGCCGCAAAATGACGCAC
ATCAAGAAACCCGTGATCTCCAAGCGCCCGACCATCCAAGGCATCTGGCAGCCGGACCTCGACTTCCCGGAGTTCAAGATCAGCGACCGCACGTAGACGT
CGATGCTACTGGTTTGGGAGAATGCAGTTTTCAGGGTCGTTAGCGTAGCTCATTAGCAGCAATGGAGTTCACTGAACACTGCAACAGCACTGCACAGGCT
ATCTCAACAAGTGAAGCATCAAATATATTCCTTCAACAGCCGCCGAGAGAAGGGAAGAGAGGTCCACCACCTCGTCTTCCACCTCCCCTCTCTTATAACT
CTTGGAACTACGAACTAGCAGGCGTGTTCACGCCGCTGCGGTAGCTCAAGCTCAAGCTCAAGCACCAGTGGCGCCATCCAGCTTAGAAACCGTGCAGCAC
CACCTGGGCGTCCGTGCAGATCTCCTGGTCCAGCAGGAACTCGCGGATGTTGGTTCGCTGGTCGCCCGACAGCTGGATGATCTCGCCCAACTCGTCGTCC
TTGACGATGGCGCCGTTGCAGCTGAAGTTCTTCTTGAAGGCCTTGAGGATGCGCTTCACGTCCAGGTCGTCGGCCAGGCCCTGCACCGTCGTCAGACACT
TGCGGCCGTTACGCTGCTGCACACGCACGTGAACCTTGCCACCGCCGATGCTCGAGTCGTCCTTGGCGTCGGCAAAGGCGTCTAAAAAGAAGCAATCAAA
TCAGTACAACGCTCCGCATCTACCTGACTACTGTACACCTCCATATTCACCCTCCTACTTCCGCAATAACGCACCGAAGGTCTGGAAGTTCTGGATGTCG
GCCATATTCGCTACGTG