Description :
From Genome Similarity Track
Location :
scaffold_247:38949- 40224
Transcript NameFunction/comments
Pl_107079hypothetical protein PHYSODRAFT_337804

Sequence
1275 bases(100 bases per row)
TACGTCAAGGTTTGGGATCCTGTGGCGATGTCGAATCTCTTGAGCGTTCACATTGACACATACGGAATTCACTCGATGGTGCTGATGGATGAGCTCGCTG
TCCTCGTCGTGCTGGGGTACAGCGATTGTCGCCTCCAAAGTCGAGCAATGCTTCACCTTCCAGAGCTGGAAGCATCTCGTCTAGCTGAAATGAACAAACA
AACAGCGAACATTCAGAAGATATGGAAAGGCAGGAAAACACGTGAGTTAATTGCGAAGTACATCAGAAGCGCAGAGGCTTCAATAGGTCCTTCATCTCAT
GGCCCAGCAAAAATAGCCAACACACTTGCACATGGCGCAACTTACCAATTAGTTTCCCGATAACAAGCACAGCTCACGATGTCTGGCCAGCCGAAGCCAA
AGCCACTGACGGCAGTGTTAACGCTCGCCGTGACCAAAGCTGGCACATCTGAGTCGTTCCGAGAAAAAAGTCATGGCCACCACACGAATGAAGAAGAGCA
GCAGACACAGTCCATGATGTACGCGGCCCGCATGACGTACTTGGATAACTCCGACCAAAAATCACCTGATCCGTTGTTCCTGACACGCAAGCAAGCTCAG
AAGATGGCGCTGCAGCAACAAGAGAGCTTGAAAGTACCAATCATGCGGCTGGAGACACGGAAGGTTAATACAACAAGCACAAACAATGGACCTACCATCC
CTAGCTGGAAAAAAGGCAAAGCAGCAATGGCAGCTTTGGAAAAGCGCCAGACATGGGAGCCACGGTTCCAAGCTGGCTGCCATTTCTACGAATGCGTTGA
GACGGGAGAATGCAGAGTATTTCCACAGGGAAATCTAGCTCTAAATGGCAACGATAATGGAGCTGGCAGCGACGACGGTGACGACCCACCTTTCCCAGAC
AGCTTTGCATTTCTCAATGATTCACACAAATAGAAAGCTTATCCCTCTAGCTCGTAAATCTACTAGATGTTAGTAGACTTTGGTGACCTCGGAATGAGTC
TCGTCGTCGTTTTTGTCGTTGTCGTTCTGGCTGTACTCCTCGGCAACCAAATCGCGCAGCTTCTGGGTCTCCTCTTTCGACATCTGCAAGTCGTCATAGC
AGTACATGATCATTCAGCAACCTACTACTTCGAAGTGTATAGGTATGATGTAAAAGATATGACAGCACAATACCTTGTATGGCGAGTACGCCTCGCTCGA
GAATCGACCACTCTCGACGTCATCACGGTAATTCTCCAGACCGATGCGGATCTGTTCGCCAACGTCTGCGTACCG