Description :
From Genome Similarity Track
Location :
Scaffold_110:38948- 40904
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_110-abinit-gene-0.63Histidyl-tRNA synthetase
Pytir_DAOMBR486fgenesh_masked-pir_contig_110-abinit-gene-0.54Conserved gene of unknown function

Sequence
1956 bases(100 bases per row)
CCTATGCTCAGCAAGAGAGAGCCATTCGAACCTTCATGACAATGTCGGATCCGTCCCCGAGCGAGCGCGAGAACAGGTCGGTGTATTCGAGAAGCGGTGT
CTGGATCTGCAAGTATCAGCGTCACATAAACCACACGACCAGTGTCAGTATCACTGCGTTGGTCCGTCTCAACTGCAGTGCGAAGAACTGCTCAACTATA
TCCACATACCGGTCGGAATCCGTAGCTGCCCACAGTCTGCTGCAGCACTTGGAGTACTTGCTGGTGCTGCCCAGCGTCATCAGCGAGCAAGTCGCGGGTG
CCGCGCACGCGGCTGACAGCTGTTACCTTGGCTTTACCACCAGCTCTCACAGCGCTGGACATCGACGCCGAGCGTGCCACGCACGCGCGTCTGCACGCCG
NNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGGCGGTCACTTGGCGTGCTGCTGCCCACATGTTGCAATGATGGAAATGGTATCAAACCAACGCTTGGTA
TCGTACCTAGTGATTGGTTTTACCTTCTCTAAGTTCGTGATTCAAGAATATCACGAACTTAGAGAGTCTAGGTTCGTACGTATCCTTGAATCCGATTGTA
GAGCTCAGAATTCCGTGATAATAAATAATCCTATCAATTGCGCGCGAACTTTACCAGACACAGATCCCACTGGTCACTCTCGTTGGGTCGAGCAGAGGTC
CAAAATGGAGCAGCAACAACAGGAGAGTGCGCGGAAGCCGGATGCCGAGATGACGATTGAAGTAGAAGCGCAGGCGGAGGCAGAAGCGCAGGCGGAGGCA
AAAGCGAAGGCGGAGGCAAAAGCGAAGGCCAAGGCGAACGCGAAGGTCAGCGTGGAGCAAGCACCGCCGCAGAACACGCAGAAGATGATCCACACGCGCA
GCTGCAACAGGCGCGAGGTCTGCTCCTGCTTCCTGCGGCTGCAGAGCGCCTACTTCCAGAAAAACCTTGTGGCGAAGCGCCGGAAGAAGCAGAAAGAGCC
TAAGAGCGAAAACAACAGCGAAGAGAAGATGGCGAGCGGCATGGCGGCAGCTTCTGCTGGTTCGCTAGTGACGAATGAGGCGGATGGTGCTGTTGCTGGC
GATGAGAGCGTTCAGACGACACCAGCGAAGAAGAAGAAGAAGCGCCCGACGGGCAATCGCCGCATGCACCGCGTCGTGACGAACCTGCAGCGTTTCGAAA
TTGAAGTGAAGCAGCTCATTGCTATGTTCCTCAAACCCGTAGAGCTCGCGAAGCTCAGTATGGTGCGTTTGCATGCTTGCATTACTGCGACTACTGCTAT
TTGTCTCTAGGCTTCAAGTGTGCTGATTGATAGAAACCACTCTGTTGGTTGGGCTATGTAGGTGAGCCGCACGATGCGAAGCGAAGTGGAGACCATCGCT
GAGATCGGCACGCGGGAGCTCGTTTCGGCGGTGTCAAGTACCGAACTCGTCCTGAAACACGCAAAGCCGCAGAGCGAGAGCTGGGCTCACTACCTGCACG
TCCAGATGAACAGCGTACGCGCGCTCGTGCTGATTTGCTTTCTAAGGGTTTCCATTGCTCAATTAGCTGTCCGCTTAACCGATTGTTTTTTTTCACTTGT
TAATTACCTCTCAACTATGTAGGTGCGTCGGCTGCTCGTGTACTACACGGGCTACAAGACGAGTCAGATGCGCCGTGACTACGCGCACTGGACATTCGGG
CTCGTGGAGATTGACCCAAACGATCCGTCGCAGGTGGTGCTCCCAAACACCTGGAAGTTCCACGAGCATGAGCCGTGGCAACGCAAGCGCGCGAACGGGA
AAGACGGCGAGTGGTTGCTGCGTCCCGGGTACAAGCGCGGTCGCGCCCCCAAGGTGTTTGGGCAGCAGGTGAAGGAGTGGGCAATCGACCTTCGGCCAGG
CTCGTTCGTTGCTGTTGCGGTGAGTTTAGTATTGCATAGTATTTCTTGTGTGCTTG