Description :
From Genome Similarity Track
Location :
Scaffold_16:389425- 391300
Transcript NameFunction/comments
g18156.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
TCTGGATCAAGCGGGATGCCGTAGTCAGCAATGGTTTTGATAGCGGCATCCATCTCGTCGTGCTCACACAGCCGAGCGCACCGTAGAACTAAGTACTTAG
CCAGTGACCCAGGGCCGTGCTTGGCTGCCGAAGACAGCACTTTGTCCCATTCACCGCGCTGCATCCACGCGTCAAGCGCACTAGTGCCGCGCCCAGCATC
GTCACTATCGCCTCCGCCAGCACTGAGCTTCGACTCCTTCTTCTCCGAGGCGTATTGAACCTTGGCATCTGCTGATGGAGTGTACGAGCTGCCAGCCATT
TTTGCTTCTGCTGGGTGGTGACCAGCAGATCCGAAGGCGCTAGCTTGTTGCGCACGTTCAAGGCGAGGGAGCAACTCCGGAGCGTGCTGTTCGCAAAGCT
TCTGTGCTGCAGCCCAGTTGTTCACGCGCAGAAAGCAATCCAGAGCTTCGTTCATCTTGTCAATAGATTGGAAGTGCTCCGCTGCAGAATCAAAGCGCGA
CATGCCTAACAAGCGCGATGCCACTTCCTCCACGATCGACTTGTAGCGACTCGGGTCGTGTTTGGCACATAGCTCGATAGCCTTCGCCCACAGCTCTTCT
AGCTCTCCAAGGTCGCTGATCTGGTCAACTGAGATCGACAGATATGCGTCAATGGCCTGGACATACTGCTGGGAGGCTACCCACATTTCACAGGCCTCCA
TAAGCTCCTCTTTCTTCTTCGGGCCACCAGAGAAAATAGCGCGTTGGTGGGCCATGTTGACTTCCATGAGCTTGTGCGGAAGGTGGCGCTTAGCGATTCG
CACGGCATCGACCCACATTGCAGCTTCCAAATAAGCAGCGAGTGCCAACTCTGGTTTGCCGGCGCTGAGGAAGAATCCTTCGGCACGCTGGTGCTCCTTG
CGCTCGATCCAGAGTCTTGCCTGTGCAATAAAGACGTCTGCAACAGACGCTGGGTCGGCGCTTTCTGCAACCCGCATAGCATTTTGCCAATCTTGCTGGT
GCACATACATGTCCAGCGCTTCTCGGGGCTTACCAGCCTTAATGAATTCTTCTTCTGCTTCTTTGAAACGCTCTTCGTCCTCCAAGAACAATGCGTGTTT
GAGATGAACTTCCGGTAGCTTCTTAGTAGCACAGTTGCGTGCAAGCTCAAAAGCGTGCTCAAACGCCCCACTTTCAATAGCGTAGTCGATCGCCGGCTCG
ATAAGTCCCAGACGGGTGAGCAGTTTGGCGCCCTGTTCACCACCCAGGTCCATGGCCCATGCATAGGCCACGCGCTTGGAAGCATTGATGCCGCCGTGGA
ACTTGGCAACACGGATAGCTTCATCCCACATGTCGTTTGAGCGGTACATGTTGACTGCAGCTTGCCACTCACCAGACTCTGCAAAGTGGTGCTCTGCCTC
CTTGTAGTTACCCTCGTGTTCAAGCTGCTGAGCCAAATACATGTGGGTGTCCTTGAGCAGATCCTTGCGGTACTTGGTAACAAGGCGAATCATTTGTTCG
TAGTTCTTGTGGTTCTTGTACATGTTGATTGCTAGGTCCGGCTCGTTCACGGTCAGGAAGAGTTTCTCGGCTTCCTTGAGCTTACCAGCACGCTCCATGC
GGTGGGCTTGCTCCACGTAGAGCCGCTCAGTCTCGTATTTGTCCAAGTGGTTAAGGGCAACTTGATAGGCAGCGTCCCATTTGTTGGCGCGTGTATACAT
TTCAACAGCATCTCGAGCAGCGTCAGCCTTGATAAAGCAGCGCTCAGCCTGTTCCAGATTGCCTGCGTCCTGGTAGTGTCGAGCAAGTCGCCGGTAGTAT
GGCAACGAAACGTCATCCTCCAGATTCTCCACAAGCTGGCTAGCCTTGGCCCACTGCCGTGAATTCAGTGCGGCC