Description :
From Genome Similarity Track
Location :
Scaffold_76:389413- 393728
Transcript NameFunction/comments
Physo_139660glucanase inhibitor protein
Physo_139661hypothetical protein

Sequence
4315 bases(100 bases per row)
TGAAATGTATCCGTTCACCTAATCTTTCAATAGTCAACTTTCGCCTCTACTTTTTATTTTTTATTTTACCGAGGCGGATGCCCCAGAGAGCGCTAGAAAC
CGCGTTAAAAGAGGACAAGACGACACGGGGTGTGGAGCCGCCACTTTACGCCCCCTCTTCACTGCAGCGGTTAAGGTAGGTGGCATTTAAGCACAACTAC
AGTAGCACGGGGGCAGTGAAGCAAGTGAAGAGTACATCTGATCTGCTGTTAGAGATGCTATTTTAGCGACGTTTTTGCGCGGAAATTTGCAGAGAAAACT
GCTCGCATACAAAACGCTAGTGTACCTTCGGGAAGTGCTATAGATAGCAGATGCACGATGTGTTTCCCTCGTGACTCTTGATTGGACAGTTTGTTCTGTA
TCTCTAATCAGGTACTATCTCATAACTAACGTCCCGCGGTACCGCGGTACGAGGAATTCAACTGCAAAATTTCGACTTTCCCCTCCGTACAACCGTGAAC
TCTTTCAACTTTGACAAAGTTCATATGCTACCTCCCGTGCAACCTCGTGATACCTTGCGCCTTTCTATCGTCAGGGACGATTACGCTCGAAAGTTGAACG
AGGTTGCACGGATACAACCAAAATCTACCAATCTACCTCTGTTAAGAACGGCCCTCAGGGCTCGGGCGGCCACCTACTCTCCATCACTGGGCAATTTACC
GCGAACTGCGCACACTACCGCCAAATTCTCCCGTTGAAGATGAAGGTCCTCTCCTCCCTCGCCGCTGCGCTCATCGCGCTCAGCGCCGTCGACGTCGAAG
CTGAGCACGTTCAACGATCCCTCATCTTGGGCGGAGGAAAAGTCCCCGTCGGCTCGAAGACGTACACGGTCGGCCTCCGGACAACTCCTGAAGGCGACAC
ATTCTGCGGCGGTGCTCTTATCAGCCCCACTCACGTGCTAACTACCGCGTCTTGCACGGCCTATGAGGAGGGCTCGTCGATTCCCCACTGGGTCGCAGTG
GGCACGCACTACCTCAACGGCAAGAAGGACGGCGAGCAGCTGAAGATCGTGTCGGCCCAGAACCACACCCTCTACGACGCTAGCAGCTTTTCGTACAACC
TCGCCGTATTGACGCTTGAGAAGCCCAGCAAGTTCGCCCCCATCAAACTTCCCAAGGCGGATGGCTCGGACATTTTCCCTCGTGTGTGGTCGAAGGTTAT
GGGCTGGGGCGTCACCAGCTACCCGAACGGCAAGCCCTCCAACGAGCTGCAGAGCGTTGACGTGCGGGTCTGGGGCGACAACGCCTGCGAGAACAAGCTC
GGCGTGGACAAGTCGTCGTTGTGTGCTGGTGGCGAGGCGGGCAAGGACTCGTGCGTTGGCGACACTGGCGATCCGCTGATCAAGGAAAACGGCCGCGGTG
ATGCTGATGACATTCTGCTGGGCTTGTCAGGCTGGGGCACCGGTTGCGGAGACAAGGATATGCCCTCTGTGTATTCTCGCGTGTCGGCAGGTATTGAGTG
GATCAACTCGGTCATCAAGAAGTAAGCAGCTTCTCTTCTCAGCGAGCTTTCACGCTTGAATGCATTTGTGCTATTCAGCCGTCTCTTTAGCTCGAGTTCT
ACAGTAGCGGCCTCAAACCAAACAGTTTTGGAAAAAAAGAATAAAAGTAAAAACTTCTGATTGGTCTTACTTTCGCACTGCGGCACAGTGTGAAGTTGTC
CGCTAAAATAACGTCATGAAGGCTCTTTGCCTGTCTACTCGCATGTGTCCTCCGCGGTGGCGTGGCTCAACTCCATTCACTTAGTTGGCTACTTGTGGCA
TTTTTCTTCTTGACGTCGTCACATTGACTATAACATTTTCAAAATGCAAATATTTGCATTGTAAAGAATGACCCGGTACAAGGCACAGCGCTGTGATGCT
GCATCGTTCTTTTTCTGAGTCAGCATTGGCCCCCTGTCGAATCAGATCCCATACATCCATCAAGTCAAAGATACAATTCCATGAAACCTTGAGCCATCTC
ACTCACTCGCCAACTTGCAAGAGCTCCGCTAACTTCTTAGCCATGTCGTCGCTCTGGCCCAGCGCGCGCGAGGAGTTCAGCCACAGCCAGAGCAGCCGCA
GCAACAGCAGCGACCACAGCGACGAGCTGCTGGGCGAGCGCCAGCCGCTGCTGGGACCCGCCAGTCCGGGCGCGCGCACGGCCGCCGCGCTGTCGCCCAG
CACGGGGCGCGCGTCGTCTCTGCGCCGCAGCTTCCGCCCGGGCGACCACAGCGGCCGCCGCTGCACGGACGTGGTGTTCCTGGGCTGCCTGGCCACGTAC
TGGATCGGGATGCTGGCGCTGGCCGTCACGGCCTTCTCGCACGAGAGCAGCGTGAGCTTCGCGCAGGAGATCAAGAGCGGCGTGGACTTCCAGGGCCAGC
CCTGCGGTGGCCGCCGGCCCTTTGTGTACTTCCCGGACTACGAGGACAATCCGGACTTTGGCTTCTGCGTGGGCGAGTGTCCGAAGGAGGACGGAGAGAC
GCTGACGGTGGAGCTGCCGCTTGAGTCGGGGAGAAAGGGAAGGAATGGGACGCGCGAGATGCAGGAAGTGCAGTTCACGTCCTATGCGACGCATCGGTGG
GCCTATGTGTGTGCTCCAGCGGAAGGTGGGGGTGTTGGTGGGCAAGTTTTGGGGGTGAGGAGGTGTTGATGATTTTTTTATTGCTTGTTTTAGTGAGATC
GGAGCAGGTGATGATTCGACAATTGCAGGACACATTGGGACGGTTTGTGGGAGCTCTGGGCAATGTATGAGAGTTTGGATAATGCGGTGGTGGAATTATT
TAATGGTAGCTAACTGTTTGATGCAGTGTTGGCAGGTGCTGATGATCGCGACGGCGGTCTCTCTGTCGACGGCGGGGTTGTATCTTGTGTTGTTGCGGTA
TTGCGGCTGCATCAGCGTGTTGATGTCCACGGTGGGGATTGAGTCCATCCTCGTGTACAGCAGCTACCGGTTGCTGCATGCCGCGTCGGACCCGCTTTCG
TATGCGAACGACCCCGTGATGCTGAGCTCGCTCCAGATCAGCACTGTTGCCATGTGCTGCGCGGCCATCCTCTTCCTGCTGTTTGCGATGGTGAATATGT
CGCGGCTTCTGCTAGCAGGCGCGTTCATCACGCATGCGTCACGCGCGCTGTCGCAGCTGAAGCGACTGCTTGTGCTGCCGTTCATCTCCTACGTGTTGCT
GCTGCTGCTCTTCGGCTGGGGTATCCTTGTTACGGTGTGCATCTTTGGAGCTGGCGAGACGTCTACGCGAATTGCAACGATCTCGGCTACATCGCCGTCC
TCTATCCGTGTGGTGACCGAGTCGTTTGAAGTGAGCACCAAGCTGCGTTGGTTGTTCATCTATCACCTCTGGGGCATGTACTGGTCGGTGAATTTCATCT
TGTCTATTGGAGAGATGATCACGGCGACGGCGATATCGTTGTGGTATTTCTCGCCTGAGAACCGAATCACAGGGCTGAAAGAGTTCGAAGAGGCAGACCC
AGTGTCCTATTCGGCAAACGCAACCGTCAAGTACCACCTCGGCACGCTAGCGCTGAGCTCGGGGTCTGTGGCCCCCGTGGAGCACATTCGCTCGTTCTTT
TTGTACCTCGAAAACAAGAACGAGTTCGACGCCAACACGTTCACAGAGCTTGCGGCCAAGTGCTGTTGTGTACGTAGCAAGCTTTTTTTTCAAACACGAT
GGTAGTTGCTGACGATCGACCGCTCTTTTATTCTGCTGTGACTAGTGCTGTATTTGGTGCTTCAAACATTGTCTGAAGTACATCTGCAAAGAAGCAGTCT
ATGTGACTGCAATCCAGGGCACGAACTTTTACACGTCTGGAAAGGTACGGGCCGTCGTGTTAGCTGCTTTCAAATGTCTGAATATGTTCTCACCAACGAA
GTTGTTTCGCTTTTTTTCTGGATAGCTGGCGTACACACTGATCTCGTCCAACTTAATCCGGGTCGGAGCTCTCAGTCGGATCGGTCATGCGTCCGTGCTG
CTCGGCAAATTGATCGTGTGCACCACCGCGTGCCTCATCGCGTGGTTCCTTCTCGAAGATGTACGTTGGCAGCAAAGTCTAGGGCTTGTGTGGGATGCTG
GTCTCATGGATATGTTGTGTCCGTTTCTCTTGAATTAGACCCCATCGCCCGTGCTGCCGCTGGTTGTTGTCGTGCTTTTTTCCTACAGCGTAGCGCACGC
CTTCATGACGGTGAGTCCTTGTAACTATTGAGACAAAATGCAGCGGTTACATTTATCTAACCAGGATCCTTGGGACAGATCTACGAGACGTCGATCAACA
TGCTGCTCATGTGCT