Description :
From Genome Similarity Track
Location :
Scaffold_666:3893- 5250
Transcript NameFunction/comments
g10325.t1POM76437.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
1357 bases(100 bases per row)
TCATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAATAGAGCACCACAGTTAAGCCTCGACACAGGTAACC
ATTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAGCGTAAATCTAGGATTCGCTCGAC
TTCATACTCGTCGTTCTCTACGTCAGGTTCCCAGCTGTCTTCTGGTAACAAGGCTGCGTCGAAATCGTCATCTTCCTCCACGTCTATTTCCACAGCGGGT
CGCTTTGGGAATAATGCTCTAGGCTTCAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGT
CGTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTCCGGCTGAGTCCGGGCTGCACCTTCGGTATATATAACCAGACAGCATCGCC
CACAGCGAAGCCAGCTCTCAAACGTTCGGACAGTTCTTTCCATTTCCTGGTCTGCTCAGCAGAACGCATGCGTTTAGCTTTCTTTTGCAGGTCTTTGGCA
CAAGCCTGAGCGTAGCTGTAATCGCGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCCTGGACGCTCGACGGCTTGGGTCCAAGCATAGCAGACA
CCGTACCGTGTGCGTCCCAGCCGTGCACCAGAAAGAAGGGGGTATCCAGTCTTGTTGCATCAAATGCCGAATTGAGAGCGAACATCAGTCGTTCTGCATG
ATCATCCCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGGATGCTCCGCACCACAGTCTGCACAGATCTCTCCTGCTGGCCGTTGGCTTGAGGACGA
TACGCCAGAGTGGCTCGCTGCTTGCTACCCAAGAGTTCCCGGAATCGCGTGAAGACCTCACTCATGAATCTTGGATCCTGGTCATGTCTTATCATAGAAC
TCGCTCCGAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAGAACTCATGGGTTTACACATCACGAACCCCGAAAACAT
GTCCTGGAATAGGAGCAAAAAAGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACAAAATCCATGGACACAACCTCGAACGGTCGTCTGGGCTCAATA
TTTCCAGGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGTAATCTACGCATTCCTTGACGAATTTCTCAACATCGGCATACATACCGGACC
AGTAGAATTCAGAACGAAGCTTCTCATACGTCCGCGTGATCCCTTGGTGTCCACCTT