Description :
From Genome Similarity Track
Location :
Scaffold_2373:3893- 5054
Sequence
1161 bases(100 bases per row)
GCAAGGGACGTCCCGGGGGCGTAGTTGCATGAGAATCGTCCAGGCGCAAGATGTTTGGCGAGGAGACCCCGACGCTCGGCGAGATCTCGCCATTCGACAT
CCTGTCGACTCGTCTTGGTCCCAGTGTGGAGCCAGTGGTAATGCTCCCAGAAAGCTCGGCGCTGGTGGAACATGAATTAGAAGTACCGGCGCAGCCATCG
TTGACACCCGTGGCTCAGGGTCGTCGGGTCCATGACATACATGACCCGGACGCGCTGCTGGAACATCTCGTCCCAAGGTCGTGTGTCAAAAAAGACAAAG
TAGTCGTCGAGGAAACGGTCGTCGTAGCTCGCGACCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ATAGAAAGGAGAGAGGTCCGCCTTCGACACTTTGGACTTGGCGATCATCACAGTGTCCCGCTCGACCGGGATGCCGTTCAGCTGGGTGCGCATCGGGCGA
TCTGTCTCCTTCGTGAGCGACGGGGGCCACTGGAGCACAACGTTGACTCCCATCACCGTGTCTACGGGTAGGGTGAGCTGTGACTTGAGCAGAGAAAAGC
AACGAAGCTCGAGAACAGGAACATCCAGACCTCCCGCGTTCAGGGCACCACTCGTCCGGCGAAGAGTCCGGCAACTGGCCTAGGACCGCCAAAGCCATCG
TCGGCAGATCGCACACGTACGATGCACCAGAGCCCGCGCCAAGTCGCAAACCCAGGATGCGGCCGCCTTCAGAGTGTCGACCGTGAGCTGCACCCGTTCG
GCGAGAGCGGGACGCCCATATGCGGTGCACAAATTCTCGATGAGCGCCGTCTGCTCCACCATCATGCGCATCATGCCTTGAGAGATGGACGCTGGAACCT
CTGTCTCAGTGAGTGACGCCAGCAGAGTGCTGACGAGCGCCTTGCCCTCGCGGCAAGAGCAGATGAAGCATGGGGATCGGAGCGTCCNNNNNNNNNNAGT
GGACGTGGAAACCTCGGGCTCAGCAGGAGACGCCAATAGGGTGTTGACGAGTGCCTGACCCTCCGGCAAGAGCAGCGAGAGCATGGGGATCGGAGCGTCC
GCGTTCTGGGCAAGCGGTTGGCGCAGTTTCTCGAGCAGAGTCTCGAACGCAGCGCGCCCTT