Description :
From Genome Similarity Track
Location :
Scaffold_690:3893- 4974
Sequence
1081 bases(100 bases per row)
TCACGCAAGTTTGGCTTCCTGGGGAAGCCGAGCCTGATTTCACTTGGGCCTTCGTACAACTGAAAAAGTTCATGGCTGAGAGCTCGGTGCCAGTGCCTCG
TGTCATCTTGACTGATCGAGATTTAGCATGCACTAATGCTACCGAGACCGTGTTTCCTCTAGCAGCTAAGTTGCTCTGTCACTGGCACATTCGGCGCAAC
GTCCTCGCTCAAGCAAAAAGGCACGTCGGTGAGGTAGCTGTTcgcaatgctgctgccgtcggtaaaaagaagaaaaacacACTCCAGACCGACATTTTCA
TGGCAAAATTCGATGAAACCGTAGACTCCGCAACCGAGGCTGCGTTCTACGAACGTAGCGCATTACTTCGCAACCTTGACAGTAAAATGGACGAGTACCT
TGACAAGCAATGGTGGCCTCACAAAGAAACAAATGTTAGATGCTGGATTGACAAACACAGCCACTACGGCTGTCGCGACACGTCTATAGTGGAGGGGACT
CATGCTACAAGGAAGGCCTGGCTCAATAACTCTCAAGGGGACTTGCTCAAAGTCTTCCAACAACTCCTGCCTTGGTGGATCTCGTCTGCTTCGAGAAACC
GGTTCCAAGCGGCCAACGACGCTTGCAATATCTCCACGCTTTTATGAGGTGACGACAGATACTCTGCGGTGGTGAAGGTTATCAGTGTCTGGGCAATGAA
GAAGTCACACGAGCTGTGGGTAAAAGCTTACAAGATTGTCGTACATGGAATCGAGAGAAGCGAATGCAACGATACTTTTCGACGTATCCACGGACGTCCT
TGTCTTCATGACCTCATGGCGATTATCGACTCTGATGGCTTATTGAAGCTCGAGCCTGGACACTTTGACCAGCATTGGTGTCTCCCCGCAGCTCGAATGA
CGACCACAGTTAGAGTCTTGGAGCCTGTTCCACTGCGAGATGGTCGATCACGCCGGCGCCAAAATGGACCTCACCGAGCAGGCCACGGAATGAACAGCAC
TCGACGAGACCCGTCCGGATttgagctcatcgagcagaGTCTCTCTTCAGAAACATCCCATACTCGCCTACCTTCATTTCG