Description :
From Genome Similarity Track
Location :
Scaffold_117:38927- 58583
Transcript NameFunction/comments
Physo_142552hypothetical protein
Physo_142553hypothetical protein
Physo_142554hypothetical protein
Physo_142555hypothetical protein
Physo_142556nucleoredoxin 1
Physo_14255750S ribosomal protein L22
Physo_142558hypothetical protein
Physo_142559calmodulin-like protein 3
Physo_142560hypothetical protein

Sequence
19656 bases(100 bases per row)
CGTATCTTCGATTAATTGCGATCACTCAAAAGGGTCCATCTCCATCCGTTATCTAATGAAACGCAAGGGTAATCAAAATGATTGCAATCGTGTGTCGCAG
GGATCTCGCTGGGCACGTCAGCACCGCTCGAGTGGAGACACCAACGAGTGGAGCGCTGCTCGCGAGTTAAATCGAGGCACGTGTAGCTCCGCTGTCTTGC
CTGCTCCGGCGCCCCGGCGCAATGCCGCGCGTCGTAAGGCAGATCGCTTTCGTTCGTCAAATGGCGGCCACAAAAACTCGCAGCGGCCACGCTTCAAAAC
CGTAGATCTTCGGTGCCGCACGGCTGTCCGGCGGGTCAAACAGAAAATCATCATTGGCATAGCTGGCAATGGCCTGGTGCTCTCGCGAGCTACACTTGTT
AGTGTAGCTAGCATAGTCTTCTGCACGAATGAACAAACCCGAAGCCTCGCATTTGCAGCCGCCGAGACCTGAAAGTGGTCGAAGCGAGCAGATCATCCAC
GCAGAGAAACCCGTGTCGCATCGGAAAGCTCCCCTAGGCCTGGGGCGCGCCGACCAGCCTCCAGGGCGGAAGGAAATCACAGCGATCACCCGCGAGCCAC
GCCACGAAGGAGGCTGCGAAAGTGCATGTAGGTAGCGACATGGCGGCAGGCGATTCTTCCCTTGATTGCGCAGCTGCTCCCCCTACCGACACTCTACCGA
CATTTCCGGATCGCCGGACACAAGCGCTCTCAGCTTGCTTGGGCTTCGGTGAGTGCTGTTCAAACAGACTTGACAAGTAACTTGTCTTAGAAACGATGCC
GATCAAGCCCCGCCAAGTCGTCCGACATCATGGTACATGTGCCAAGCGATGGCAAGCCGCTGGGTTGGTGTCAGCCACTGCCGTGCAAGCCAGGGCTTCG
CACGAGGATTAAACCGTACAGGGCGGTACGGCTCGCAGCGGACCGCGGGGCCGCTAATGGAAATTATACGCAGAGGTTCAGGAGCGATCGTGGTGCTGCA
CTGTACGCCTGGCAAGGAGGCCAAGGTTCCGATAAGCTCTACCCTACTCAAAGGATCAATCAGCGTGTGGCCGGTGCCGTCTCGATTGACTGACGCTGCC
GTGCTTGTTGTGGCCGGGTTGGGCTGGGCCTCCGGTAGTCAGTCCTGTGTGGCGTCGTGGCCAGCCGTCGTGGCCAGCCAAAGTGTGAAACGCAAATTGG
GGAGATCTTCAGTAGCGCATGGACGATAGCGTGCCCAAAATACTGCTACACTGTTCTGGGCTCCCGCATGGTGCCACCATTCTGGTACATGCACAGCGTG
AGCACGAGCGCTTCCTGTCGCGCTCAAGCCTCCACCGCTAGCACGGAGTGAGCTCTGCGGATCGCCTTCTCATTGTACCGCTGTGGCGATCGCGCTGGTC
GTCGTGGTGCTGCTGTTGAAGCTCATAAAAACAACAGCGTCGAGCTCCAGTTTGTACCGGCGCTTCGGCAAACTTGGCCACTGTATAGGCCAGAAACGGG
CCTTTAGTAGAGCCCAAAAAGCGATATGTAAATGGAGCCCGAAATAATCGATGACCTGGCTGCCGTCCCATCCTGCGTGCTTCAACGCAGATCCAAGCCT
CACGGGCTTCGGCCAGGACAGCTCGCTTGGAGCCTTGCTTACGAGCCATGATGACCTCCGCGACAAGCCTTCTTCGCAAGGAGAACTCTTACATTTGGCT
CATTACACCGAGCTCGTTAAGACCACTCAGCTGAGCTTCAACCACGCCCACGGGCGTCAACGCTCGCCATCCACGTTGCGTTCCTAGCGAGACGCGGCTT
GCACTTTCGGGTAAGTAACTGTGTGTTAATCAAGGTGTTGCCGACCGCTGCGGTCGGCATGTCCGCTTGTTCCTTGGGCACAGGCACTCGACCCGCCGGA
CTTCTGCACGCGGGGCGGCATCGTCGGCAACTGTCCTCCCCGCCAGCAGCACTCCACCGTGGCCGTCGAGTCGACGGCCCACAGCAGCGCTCCAGCCAGT
GAGACTGCGCTGACCCCGTCGCTCAACCGGTCCTGTTTTTTCTCGCATCTAAGCGGGATGGCGGTAGGTAGCAGCACCGGGGCCCCGAGGGAGTGTTTAC
TGACCATAGAGGCTCTACCGACATTGATAGGACGTGCCGACCTCCAACGTGGTTGTCCTTGAACGGATCGCCGCAGCGCTGCCATTCCCAAATTCGCCTC
ACAGCGAGCGAGCAAGCAGCCAGCCAAGCCAGCGGCACTTCTCTCCGGACACGCCACCGACAGTTCCAGTCTCTCCGTCACCATGAACGCGGTTGCTGCC
GGATCAAGCTCCCCTGTGCCTTCTTCCAAGCCCAAGGCCAAGCCCATTTCGCCGACGGCCAAGGGGATCTGGTCGCTCGAGGAGCATGACCGCTTCCTTG
AGGCCATGAAGCTCTACCCCAAGGGTCCGTGGAAGAGCATCGCCGACCACATCGCCACTCGCTCCGTGCGCCAGGTGCAGACCCACGCGCAAAAGTATCA
GGAGAAGGTGTCGCGCCGCCTGCGTGGACTGCGCAAGTCGAAGAAAAAACTCGTGCGCCCCGAGCACCGCATCGACGACGACACCATGGAGCTGTGCAAG
CTGGTGGACTGCGCGGCGGAGAAACTTGTAGCAGCAAGCAAGAAGTCGTCGTCGCGAGCCAGTGGACCCAAGCTCGAGCCGCTACAGAAGAAGAACCTGG
TGAAGGAGGAGCCCGCCGAGGCGCATAGCAGCCCGCGCGGTACCGACGTGGAGATGAAGACTGATGACTTCTTGCCGCTGCCGTTCCTCGACTTTGGCGA
TGACATCGACCTGGATCCCGTCCACATCCCAACGGTGAGCGAGTCACTAGACTTCCTGATCGACTACCTGTCGATATAACCTCCTGCAGCTGGGGATCAG
TTGCTATTAGTTCGGTAGCGACGGGATAGACCCGTCATTATTTGGTGAGGTATCCGTGAACGAGCCCCTCGTTCCACGCGAGGTGGCTTCATATTTATAT
CATAAAGAGGAACCAATACAAGCCTTTATCAATGGGGAGGACGTGTCGACGGAGCAGCTTGGACGGACGGCCACGGAACGCGGCTGGAGACCCGAGTTGA
TCCCCGACACAGCAGCCCCCGCTTGATCCTTCGACAATGGTGTTCCCGTCTTCGGATTGGGGTGTCATTTGCTTGCCGTCCTGGACTCCCGTGCCGGTCC
AATTCGGTCATACTGGGGCGAGTGCGCCGCCAAGTTCAACCCCCCAGTCATAATCGCTGGCGCAATGAAGTGCCATCACTCTCGAGGCAATGCGCCGCGC
AGAGACAAACCACCTCCATTTCCTGCGCGCGAAGTGCCTGCAAGGAGTTCTCCTCGCTCAAGAAACTGCCGACGGCAAAAGTCTGCGTTGAGCGCGCCGG
CTTCCTGATCCCGGTCGATGGGCGATCCACAACATGTGTCGCTGCACGTCGTAAGGCTCACTTGCCAGCAATGCTGGCGTTGCTGGCAAGTGAGCCTAAC
GACGCGGAGCTCCTGATCGAGGAGAACTCGGCCGAAACCCACGGCCCCATGTGACAACTGGCCGCGGAGCCGAGTCGGCGGTCAGCGCACACGAGCCCCA
GCACCGCAACAACTTGCCAAGCTTGGAGTGCTTCTGCTGCATCCAATCTCCTTGCTTATGTACTGAAAAATAATCTAACCGCGTCGCAGTACGCTTCACC
TACTATCTTTGCTCAAACGGATCGTTGGGATGCAGCCTACTGAATTACGAAATAGTCCTAATGACGTGGCGCGTTGTCTCATATTCAGGTTTGCAGGCCG
GATTTGCTTCGATTGGAGCATGCCGAGCTTTTCCAGGCTGGAAGTGCCAGCTTGCTTTTGAAAAGAGGTAATTATGTCACAAGCCAATTGCCATCGGTTT
CTCTAGAGATTTCATGCCGGCATCGACGAGCTTTAGCTTGCGGCGAGAATCTCTGCGTCGAGAGCCGGCGTTGGCAATGATATGAATCAAATCGCCACGT
GGGAAGTGCTGCACGGGGAAGGATATTGCCGCTGCGTTGAAGCTCCTGCAGGTTCAACTCGGGCGTCGTGTCTACGGCCTGCCTTCAACTCGCCAAAGCT
CGAGCTTGATCGACTGGAGCAGAATGCTTCGTGCGGCTTCACACTCTGGCAGGCAGCAGTGCTGACACACGTTGGTTGCACGAGCATGAAGGCAGCGGCC
AAGCGCGCGACGGCAATTCGATCGAGTCGAGCCCTTCGTTCAGCGACTGTGAATCAAGGTTGCGCTCGGTATCCTAGGCGCGTCCACGGAGAGCACGACG
ATAAACATGCTTATGCCTCCAGTGGCAAACCTAGCGTGAGCCCCCAAGCAAATTCTGCGCTTTTGGTTTGTATTGGACCTCGTATCTGGGTGATGTGCCG
AATTCTATCAGCAAATTGCTCAAAACCTGTTCGAGATGAGTTCGCACAGCGTTGGTGTATGCAGTGAGACTATCACGGTGGGGATACATGACCCGCGGTG
CAGACTCCGCAGAATTCGCGCAGCAAACACAAAATTTTTGTACCGTCTCCATATCCCAAGCTCACTGTACCCTAATGCCAGCTCGACCCAATGCATCTGC
GTGTACATGTAGTATGTCGAGGGATCCGTTAGCCCTTATGCTATATCCTTATTCATCCTCGTAACACGACACGAAAGCAGTGCTTTGGTTTAGGTCCTGC
ACGTTCGTCGTGAATGGTCCACCCTCACGTTATCAGCAATTCCGACAACCACGGCTGCATGGACACGCAGCGTCCGACATGACTCAAGCAATTACGCGAG
TCCATGACATTTATATTACGGCGGAGTGGCGGAGATGTTTGCCACCACGCTCATTCATCGTGCTCGAACGCATGCAACTCAGCTGGAATATCTACATTAG
TGACGGCATGTTTATCTGCATCAGGAATCACAGAACACGTGCCGCTTTGTCGGCTGTGAAGCTCGAAACTCATGTAAATGACCGAAGTGCTTTACAGCTT
CACACTTGGGGAGCACGATGACATCGCACTATAGCGAACAGCATTCAATTTCATCGTGTTTCAGGGAACTTGTTTTCGAGGGTACACTTGCATGAGTCTG
GTCAACGCTTGTTGCACCTGTATGGTAGGTGCTTGTTGCCGAGTTCCTTCTCGTTAAAATCAACGTGGTGATTTTGTAGTCTATAGTATCGTGTGTCCGC
GATTCATCGTGCGCCACCATGAGCCATGGACCATGACCGATGGCAAAGCCTCCGAAAAGTATAAACGGTTGGGATAAACTAGTATGTACGGTCATGGCCG
GCAACTTCGCAGCCCCGTGACATTTTCACAGCTTGCAGCGGGCATTATGGTCACATCTATGACAACAGAGGCAAGTGCAGTATTTTGACGCCTGCAGCGC
GTCCAATTCCTGTCTAGCGATGCAAGGCTTGCTTTTTTCCTTACATCTTGATGAGCCAAAATATTGTGCCAATATTTTGGTAATTTGTGCACCACAGGTC
ACAAAATTAGGTCAGCTGCGTTGATTTGCTTGATGACCACGCTCTCGGCTTGACGACACCCGAGCAGCACCGGCACGGCAGACTTGAAGGCCCCGAACTC
GTTGAACGCAGACCCCAAGTAGAGAAGGAGGAAAGGGGCGCGCTTTAAATCGGACCCCGAATGCAGTCTTGCACTGGGAAACCGCCACTAACTGCCGCAT
CAAGAGCATGCGCCGCCAACCTAACCTTGGAGTGTTGAAACTACTGTACCTGTTGCTGAGACTCGCTCAACGTTGACCCAACGTCGTTGAGATCTCGTTA
GATCGTACTTCAGCACTGAGGTGGTCAACAAGGTCACGCAGTACAGATGGCAGCCACGCATGGATGGATCGCGGACACAACCTGGCAAAAACCCTTTGGG
AAGAAGGAAGTGTGTGTGTGTAAATGAATGATATTATCTTTGCAGTGGGCTCGTTGGCCGTGCAGGACTTCTGTTGAGGTGTTACGGATTGCCGCAATGG
CGCAATAAATTAGGCAAGAAGCAGGTCGATGGATTCCTGCACGTCTTGTCGGTAGGCGTCGTTGGCCAGGACGTCCTCGAACGAAACTCCGGGCGTGTAG
GGCAGTGGCTCCAGGCCGCTCAGCAGCGTATCCATGTCGACATCAATCTCAAGACCGGAGAAGCTGGAGCTGGAGCAGCTGCTGCCTGCGTCGCTGGCTA
CGGGGCTGCATCCGCCCGTCAATAGCTGGCCAAAGCTGCCGCTGAGCGGCGACATCGCACCGACTGGGAAGGCCGATGGCGAGCGCGGAGAGCCCTGCAT
CGTGAAGTTCTTGACGCGCTGGATGCAGCCAGTGGCGTGGGCGTCGACGCGGTGCTCCGGGCGCACGAACTTCTTCTTCTGTTTGCGCAGGCCGCGGCGC
CGGCGGTTGATCTTCTGCTGGTACTTCTGCGCGTGCGTCTGCACCTGCTTGATGGAGCGCGTGCCAATGAAGGCGGCGATGGAGCGCCACGGGCCGGTCG
GGAACATCTTCATGGCGTGCAGGAACTGCTCGTGCTCCTGCTCGGACCAGAGGCCGCGCGTGATCGGCGTCGTGGGCGCGGGCGACGCGATCACCAGGCT
GCTGCCGTGCGTGCTGGTGGGCATCATGATCATCGTGGGGGCTGCTATGGTTGCTGAAGTGGTGTGGTGCTGCTGCTTGCTGCGGGGCACGAGCAAAATT
CGGAAGTGAGCTGATTGATGTGACTTTGGCGGCGGAGACCCGCTGGTCACTTTTTTAGCTCTTGACACGTAGAGTGGCTCTTCTCTGAGCGAAAACGGGG
GGATGGGCCACTCCGGCGCGGCTAGGGCTAACTTGTGGCTCGGAGCCGTCCGAGGCAAAAAGATTGACCAATGGCAGCTGGGCAGACTGCGGGCTCGTCT
GTTCAGTACCGGTGTACAGCACGCCGCGGTATCGCAGATGGGCGCTAAATTATCGCTTGGTAATTTACGCCCGCCGCCCCGCAGGAGCATGCATGCCCTT
GGTCCGCCTGCTGGTCGGTGGAGCATGTGCGATATCCGAGCCGCGCGCGAACCAACTTGTGGCGCGCAGTAGTCGCGGCGCCAGGCGGCTTGCAGAGACG
AGCTGCGCCGGTGGTGTAAGGCTATCCAGCGACACTGGTCAGACTGATGCGTGTCAACATTTTGCTGTTTCATGTCAGCGCTGCTGCCGCATTCGGTTGC
GCTTGTAGTGCAGCGGCAAAACTGTCTGCGGAACCACGTCAGTGCGAAATGCATTTCGTCCGCGTTCTCCGCTGGAAAGCAGTAACCACAGCGGTAGGGC
CAAGTTCCAGCACGCTGCAGCATCGCATATAACGTCGGTGGCGGCGCAAATAGCATATAACGTCGGTGGCGGCGCAAATAGCATGTAAAGGCCCCGACCT
GAGCCGGTTGGCATATTTTCGCGTCGAGCTTCCTCGAGCGCACCTGTTCGTTCTGAGATCACTTGCGGTCACACAACTGGAATTTCGCTACGTGGGGGCA
CTTCGACTCCTTTTGCCGCAGCAGAGGCCAGATGCTGGAAATCATGGCTCGTAGCTGATTGCTTCCAGCCTGGGGCGGCCTACACAATCGGATAGCGGTG
TTTCCAGGCTCCGGCGGTTGGGGCGTTCTCTCTTATGCAGCTCGATGCGACTGCGCTGTGACGGCTACAGGTGCTTGATAGCGTTGGAGAGGCGATTCGT
CGTCACCACTGACTCACTAATCTCCCCGAAAACCACCTGACCGCCTCGATCGCGAGGGAGGGAGGTCTGCCGAGGCAATAAGCAGGAGAAACAAAACGCC
GCCTCATATTCAAAGTGCAAGAAAAAATAAATTACTTCGGAAGCCTTGTTAGCAGCATACATGCGACATGCATATGCGGTACGAGAGTTCTTTCGGCGGT
GCTGAGATCCAAAAAAAGATCGCTAAAGCTGAAGGTGTTGAAGTTGCCTTGTCCTCAGGGAGGATTTCTGTTTTTAACAGCGCGAGACCAAAGTTTTTTA
TTGTCCGTACCGGCACACTCCTGACACTGCGCTACGCCGTAATAGCGCTCGAGTGCGGCCTGCCAGACGCAACGCCCGCGGAGACGTGCCCGTCGTTCGG
GCGGCTTCCTCTCGCAGGCTTTTCTTTTTCTCTCCTTTCGCTTGCACGCTTTGGTCCACCAGAGTGGCATGGACTGCCTCAATGCGGTTGCATCAAGCGG
TTGCTGACTCGGCGCACAAAGCTGGTTGTGTATGAGACACCGCCTCCTTCCGCCGCCGCTGGCTGCATGCGAGGCAACGCCGCTGCGACGCCGCCGGCTC
TTCCAGGGAATGAACTCCGCCGGGCAACGCTGCAGCTCGGCTCCTCCAACGCCGCGCAGCTTTTCATTTTTTTGAGTGGATTCCTCCGCAATGGCTGCGC
CGCCCAAATGCGTGGCAACTCCCACCCAGCCACAGCGAAATCGCTCAGCGGCGAGCGGCGCGCTGCTCGCAAAAAGCCCCGACTCGGGGGTTAAACAAAC
AGCTTCAACGTGCTAATATAGCGGTGTTATCCGCTGTCAGCGAGCCGGGCGGAGCAGTATGTACCGACACGAACCTTCGCCGGCGTTCGTGGGCGCCGCA
GGACTCGTATGTGTGTGCAGAAATAATTGCGGTATCAGCGTTGCCAGTCTCTTCAGCTTGCCGCCCATCTCCTTCGGCGAGGACAAATCTTGTTTTGTGG
AATTCGCACAAATTTCGCATCGCCGCGGAGCAGCGGCACTGTAGCCGCTGCGGGCGGAGTCGGCCGCCATGCTGGCCGCGCGGAGACCATGGCTGCGTGC
GACAGTGAGCTGGCCGCGGCGGATGTGAGCTGCTAGCGTCGTTCATGGCAAGGTGCGCGCTGCTGCAGGGCCTCCCTCCCTCCCCCTGCGAGGCGAGCTA
AGCGCGACGAGCTCACACACATGGGGAGCGATACCGCGCCGCACGCAAGATCGCGGATCGTAGTGGCGACGCGGATGTCGTCGCAACTGGGCGAAGTCTA
TCAGGGCAGGCAACTACATGTACGGCGGAGCTGCAGTCCAGAGCAAGGCGATGCAACGCAGATGGAGCGATGCTGCTGCAATGTCTGCGGTAGAATTGGT
CGCTGAGCAGCGACCCCCGTGTTCGACAAGCTTCGGCACGGCTGGAGAGCTGGAGCCGACCTCGGGGAAGTGGGGCTGTCCATCTGAGTCGTCTGCCAAC
GGCTAACCATTTGATCCAGGCGCGGGAGGCTTGAAGCAAAAGGCAACAGGACCAGATCACGAGCGAGCTTTGTATCACAGCGTCCGACGTCGCCATTGTG
TCTCAACGCTCCCCGACGTCTCTGATCGACGTGCCGGTGCTTGTCGGATGCCATTGCACTTCTGCGACGCGCTGGCCCAGCCGGGCTGGGGGCTGGCGGC
TCAACGCCATGTTGGCTGAGGTCGGAGGCGACTGCACTTCGTTAGTAGAAATAAAATGGCATTAAATCATCATTAGTAAGTCGCAAGGCCAGCGACCACA
GCACTGTCGCTCACTCATGCGGCTGTGGACTTTCGCCGATGCTTCAGTGGCGGCTCGCTCTTCTCAACATCGGCCTTCCCATCCTCTTCCACTGAGGCCT
CCACCTCCTTCGCCGTCACTGCCACGCTCTTCCTCTTCAAGCTCTTGCGGGCCTCTGCCGTTGCAGCGCGCTTGTCGATCTCGAACTCGAAGCCCACGGG
CGTCGTGAGCTTCGGACGGCGAACAGCCGGGACGCCGACGCCCCCACTGGCCGACAAGGCTCTGGAGAACTGATCGCTCCTCCCCGGTGCAGCTCCGTGC
GTCGTGGCGTCGTGGTACTTCTGCGTTTTGCGCTTCTGGGCCTGCACGCGCTTGCGGATGGCCGCGATCTCCAGCAGCTCGCGGGACGTCCTGGTCAACA
TGTCGGCGCGCGCACGGGGGGTGGCCTTCTTGAGCTTGTGGAACTTGGGGGACTTGGGGATCGTCAGGCGCCCGTTCTCCTTGGCCACGCGAGCCAGCCG
ACGCCTCTTGCGCGCCACCTCGCGCGCAGCCGCCAGCTCCTTGTCCTTGCCAGTCAGAACCTTCTCCCTTGAGGCAGCCAGCGACGCTTTGGTGGGCCTC
AGCAGGCGGTCCGAGGAGGAGATAGGTCGCACTCGGGGCACGGGCGGGGGCACGCCGCGGTACAGCGCGTCCGGGTCTTCGTCGAACGTCGCGGGCGCCA
TGCTCACTGCGACCTTGGTATCCTGGATAGTGTGGACTCGACTCGATGCTTTTCTTGAACTGCTTACGCGGCGGGAGAACGTGGCATACAAACTCCAAGT
CACAATTCAAAATTCAAATATTGATCAATATTGACCAATCGTATCAATAAATTGCATTTCTACCAATGAAAAGATAACCTATTTTCGTTGAAGTGCATGT
TGTTGTGGTCCCGGATCACCAGACGTAGGGATGCCCCCGACACGATCCCGACGCCATTCTGTCGCCCAACAGGGTAACAGTGATGATCTTAGCGCAGTTC
AGGCGCTGCATGTGTCTGTTCCTCTGAAACCGCAGCACACGCCGACTGCGTTGCCCCCGCGACTGACTCAAGCGGTCAAAGATGAGTTCGCCAACCGCTA
CCTGCAGCAGATCGGTGCCAACTCCACTCCGGAGAACATTGTCATGGTGTTGCAGCACTTACCACTGGAGAAGTGCGCGGTTTCGGCAGCCTGGAAATCG
CGCGGGTCCCTGGCTGACGTGTTGGCCATCGACCTGAATCCCAAGTCCCTCACGCAGGCAGGAGAAGCTCCAGTCAAAGGAGTTGGTGGCAACCGAGCTG
AGGCGGCCAAGACTGAAACGGAACCAGCATCAGCACCAGCTCCAGCTGCTGAGCTGTTCTCACCGAGACGACAGCTTCGGGGTCAGCAGACTCGTCATGC
CTTCCAGATTGGCACGGTCTCTTTCACTTTTGACGACATGAAGCGAAAGTTCCTGCTACCTTTCAAGCTGGCCACTCCCCCACCTGAGCCCGATGTGTTG
AAGCTATACGGGACTCATGCTGCAGTGGATGCATTGTCGCAGAACCAAGTAGATCAGGCTGGTGCTGCGCCTAGCTCACCGAATTCTGTTCGCAAATGGA
AAGCTCAACGACGACTCAAATCTGTCGACGAACGGTGCATACCGCCAAGCTCTAGCGACGACACTGTGGCTGAAATGCACAACGAGTTCTTCCTAACCCT
GCCTCTGGCAACACTGGGGCTGCCCGAGGGTGATGAAGATACACGCGCAGTGCTTTACGAAGCTTTGGTTAGTCCTGCCATGGTAGAACTCGTCCAGAGC
ACCGTGAGATATCTCTATCTGACGGTGATACACCCGTCCACCACTGCCAAAGGGGGCAAACGTAGCAACTATGAGCAAGACGCCCTATTCGTCTCCATTG
CACAACGGTTTGCGATTCTGCGAGCGAAGATGGATCGCAAGCAGCGCTCAACCGCACGACCTCAACTCGCGGTGCTCATTCCATTGCTGCTGCTTGCGCT
TCGCGTTGACGTTGAGACTCTTGTACGACTGCAGTACCCCATGAGCTTCGCATGTGTCGCTGAGGAGATGGCTCGAATTCTGCAAGTGATGGACGAGCGC
ATCTCACAGCTCCTGGACCCTGATGCGAACTGGAGTCGTCTAGCGGCACTGGAGACAACCCACGAGGCAGGCCAGGCTCGAGCGTCGTCTAGCTTTCAGC
GAGCTCGTCGTCACCGACGCCTTCGAGACCAGTTCTTCCAGACCAGCGCCGTACTCCACGGTCTCTTCCCAGACCCCTCATCCGGCAAGTCACGCCGCGT
AATGACTCTCCGTGGCGGTGCTGGGATCAGCAACTACCCCGAGCTCTCCAGCGATCCGCCCGAAGCATTATTGTCGACGCTGTCGAACAAGCAGGACGAG
CGTCGTCTTCCAGGCAACAACAGCCACAACAGCAAAGATGCAGCGATATCCGTCTCGGTCGCCTCCAAACTCTCCCTTCTCCGGAGTCTTCGCCGCTCGC
AGCCAACCTAGTCAAAAACAACCAAACTGCCGAGCGCTACTAAATCATAGCAAAAGGGGAACATCATATTCTTTCTCAAAAAGCTTGGGAAGAGAGAAGA
GAGAGAAGAGTAAAGGCAACTATACAACTGATATCAGCTCCAAAAGAATCCGTGAGTTCAACCCACCGACGACACCGAAGGAAGCCGCGTCAGATCCTGC
TCGCTGTCCTTTACTTGGTCAGCTGCTCCCAGAGCTTCTCCACGTCTCCGCGCGAGTTGGCGACGGCGCTGCGGCCGTCCATGGTGATGACCTTGCCCTC
GCCGTCCACGAAGACCAGCATGGGGATGCCCGTGACGCCGAACTTGGTGCTCATGGCCTGGTTGGCGGCGCGCTCCTCGAAGGGCAGCGCCAGGAACGGC
ATCTCGCCGAAGTACTCGCTGTACTGGGCCGGGTCGCGGTCCGACGAGATGAAGATGAGCTCGAACTCCGGGTGCTCCTCGATCATGTCGTCGTACACGG
CGCTCAGGAAGGGCGTGAACTGGCGGCACGGCGGGCACCAGTGCGCGCTGAAGTAGAAGCCCACGACCTTCTTGCCGGCCAGCTTGTAGTCCGTGTCCTG
CAGGCCGTCCTTCGTCTGGAGCTTGGCGCCGAGCTGTTCCGACCACTTCATACTGGTTGTGTCTTGTCTGTTGGCTTGGTAGCGAGAGATAGAGTGAGCG
AAGGAGAAGAAAAGATGAGGATATCCTGGAAGACTGTACTGTGACGGACACAATAGGGTGAGAGCAGCTACGTGGAGGGGCGCTGCTCGCCCACTGGTCG
GGTGTTCCGTAATCAAAGCTTGGGTAGGAAAAGTCAGCCCGGAGGCAGTACCGTGATGAACATGTATACGAAAAAGCAGTCGCGAAGGGGCCTAGAGTAG
AGTCACGACGGAGACCGTGAAGATGAACAAGTTGACGGGGGTCAACAGCACCTTTAATTAAGGTTCCACCAAGGAGCAGAAGTTCCCGATGGATTTGTCA
ACACCAACCGGTTCGTCTTCCTCTCGCTCAAGGACCTTGCGATGAAGGAGCTGCGAAAAAAATGCCGTCCCATTGTCCAGAAGAATACGATTGAGATCTA
ACTCAGCAGAGGCCTTTCAGCTGAAGAAATACCTGACGATGAATCACGAGAAGCTGTATACGAAAAATAGCTGTGCATTCGTCGTTATGGCCATCAAGTG
TCCGCTTGCCCGTGTTTCTAACGTGGAGGCGCAACCAGACCAACACTAAACTGTACTAGCGCTCTCCCCAAACGGGCTGCATCCCCCTCTGAACTTGAAC
GTTGAACGCACGTCTGTCTGCCTCTGCATCTATTCCTCCTTGGCTGCCTCCTGCTCGAGCTGCTTCTTGGCGTTCTCGCGCACCAGCTTCTTGGTGAGGA
AGCGGTTCAGCGGCTTCTTGGACGGGTCGAACTCGCGCAGCACCACCGTCAGGTGCGTGTACGGGTGGTGCATGATACCCGAGCGTCCTGCACTCGACAA
ATGCAGCCAAAAGTTAGCAAGTCAACGCTTCTCACCGCAATAGAAGCAATAATAAACAATAACGCTTCAGCCGTGCGCACCTCGGCCCATGATCCGCAGA
CGCTTGAGGTAGGTGCCCTTGTTCACGAAGCACTCGGCCACCATGAGGTTCTCCGGCTCAATCTGGTACTTGATGTCGGCCAGGTTGATGGCGTTCTGCA
CCGTCTTCTGGAAGATCTCGGCCTTGCGCTTGGGCGAGAACTTCATCTGCAGGATGGCCTCGTTGGCCGGCAGGCCGCGGATCTGCTGCGCCAGGTACGT
GAGCTTGCGGGGGCTGGCGCGGATGGCGCGCTTCACGGTCTTGACGGTGCGCGGCTCGGCGGGCGACGTCGAGCTCAGGAACGCGGCCGTGTCGTCGTCC
GCGGCCGTCTCGCCCTCCACGGCGGTCGTGGACAGCGTTGCCCGGGCCACGCGCCCCATGAAGGCGCTGCCGGCGGCCGGGCGGAGCGTCAGAGCGCCCA
TCTGCGAGCGCAGCGAGGCCAGCATCTTGTCCCGTCGGTGAGTTGCGGAGGGTTATTGAGCAAAGACCTCTTTGCTGCCACACATCGACCCGAATCTGCG
AAACTCGATAATTGCATGGCGGTAAATAGGGTCTGTGAAAGCTGATAGTTGTTATTACATTAGAGAGGTTTACAGATGGCTACACTAAGTTGAAGTGTTC
CTGTGCTGTGCTGTGTGCAGCTTATTGAAATCGGAAATGAAGCTCTACAAAAGGCTCTCTAACTAATAGGCTGAGCGTCACGCTCGCAGCGTAGACCCAC
CCTCCATATACGACGTGATATGTGACTTGAGTTTTCGTCCTGTGTGGTGGGGGGCCCTCCTTCTCATCTGCCTTTATCGGTCTGCTTCCACGTCACCACA
TGCAAAATACCCTGGTTGGGGCGCTCACGCAAACGGCGACGTGGTGCGCGTCTTCTTGTCGGAAATCCAGATGCGCAGCTTCTCTAAATTCTCGCGCGGT
GCCTCTGTGCCGTCCTCGTCGCTGCTACCGTAGGCTCCGGCGCTCATTCGATCTACGCTCGCACGAGCGGCAGCGTTAATCTGGTCGATGTCGTCCGGCA
GCCACTCGATGTTCACTTCGATGTCGGTTCGGTTCGACACCAGAGGCATTAGATATGATACGAATCGCTGGCGGGCTGCGGGGGGAAGGGCCGGGATCTC
GATGCCGCGCACTGTGATCTTGGCTGCAGCCGTCCCCACCACAATATTCGCAATCCACTCGCCCAGGTACTCGAACTTGTCCGGTCGCCCCTTGCAGATA
TCGCGGCGCAGTGATAGCAGGAACTCGGGCGTGAAATGCTTGCACTTCTTCTGTAGCTTATACTGCACGATGGCCTCGCTGAGCGCCTGCATCTGCTCCG
TGTTTTCCATGCCGTGAGTACCCAAGTCGTAGCACTCCTTGCACAAATTGTAGTTTGAGCACACGCTACAAGTCCAAAGCGAGCCAACGATGGGATCCAT
ACCGCATCCATCGCAAAACGAGTTCTGATGCACAATAGTTTTCTTGCGCTTCCACTTGGAGCCGATGATCGATGCGCCCGTACTCATAGCCGCTCCCAGA
CGACCCATCAGCGGCTTCGAAGGCGAGTGTTTCTTGTCAGGCAGACTTTTGGACTGCGAACTGTCCTTGTCATGTACGTCCCGTTGGAACACGAACGTTC
GGGGGAGAGTGGATTTCTGGATGATGTCGAGTACTTGCTCCTTCGTCATGTGGGCCTCGATGTGCTGCCCGTTCACACTGATCAAATAGTCGCCCACGAC
CACGCCGGCGCGGTGCGCAGGGCTGTCCTTATCCACACTCTCGACCTCGACCAACAGCTCGTTCTCCAGAGACACCACGACGTTCGTGTTGAAGCCCAGC
ACCGGCTCCGTAAATGTCAGGGTGTATGTGTTAAGCGGGTTCTCCGTGTAGTCGGCTTCGGATTGCGAACGCAGTCCGTTCTTCATGTCTGGCGCGTGGA
TAGCACTCGCGCTGGACGAATTCCGGCCGGAAGACTCCCCACTGCTCGTCACGCTCCCGGAGCTAGGTGGGACCACCGACGCCTCGCTCACAAAGCGAGG
AGGCTTGTCATGAAGCGCAACGCGGCGCAAGCTGTGCAGTGCACGAACTGACGATGGATCGGAGGCCACACTCGGACCCAAGAAGCGATGTGACGCGAAC
TCATCCTGCTCGCCGAAGTCCGCAGCGCCACCATAGCCCAGAGGCGTCCCGAGATCAGCCCCTTCCTCGTCGTCGTCCTCTCCAGCTGCTTCACCTTCGT
CGCTATCACTCGCTTCATCGTCGATGTCGTGGTGCACCAGATCCAGCGGGGCCGGGCGCTTGGGCGACGGGATCACCAGCTCCACCTCGTGCGCCTGAAC
GTCCACGTCATGGCCCTGTAGCTCCACCTTGTCAGCAGCTACAGAACTAGCAGCAGAAGGCGACGACGGCGACGGCTGCGCTTCCTGCGCAGGTTCCTGT
TCCAGCTTGTGGTTCTGTTGCACAACCTCCTCCTCCTCCGCTTCCTGCACTACCAGCTCGACGCCAGCAGTGTCGTGGTGCTCGTCGAACGTCTGCTCTG
GGGGTGCTTCACCCACGGGCGTCGTGGGTTCGTCGTGCTCCTCTACAGGCGTCGAGGGCTCTGCATACGCCTCAACGGGCGTCGTCGGCTCCTCCACGGG
CGTCGACGGGCCCTGCACCAGCGTCACGTCCAGCTGCGGCTGCCTCTGGGGCTCCTCCTCGTCGTCGTCGCTGTCTGTGCGCGCTCGGTCCGACTCGGCG
CCGTCTTCGTGGGGCTTGTGCAGCTCCAGCGGCGCCGCCACGGGGCTCTTCTCCGTCTCCACCTCGGCCACGTCGCTCTCCACGGGCGTGGCGGGGCTCA
TCGCAGCGGCTGCGGGCTCGCCCAGAGCGCGGGGCGACTCCGCGTGGGGCTTGACGGCCGGCGCCTCCATGTCTTCGGGGTGTAACGTATTGTGGAGAAC
GCCTGCACTGCGTTCAGTATTTTATCGGCGTCGTCCCTTTGCTGAAAATGCGCGCTATAGTGAAACCAAGTGCCGCATTTTCACGTTAGCCGAAAAATTC
AGGATAAAACCGTCGTTTTCGCTTGGGCTGTACTGTATTACCGTACCGCATGGCGGAGGGGAAGCACCGAATTGGTGCCACCGCATGGGCGCCCCCGCGG
CACCGACTCCGTATGGCACATGCATGCGTGCTCGGCGACATTTATGCTTGTTGTTGTCTCGAAACCAAGTGTCGAGGAGTCAAGGCATGCAATGTGATAA
CGTCCTCCCTTCTGGACGCTCGCCACGAACGAGCTGCGCTCTGGGTCAGTCCAATGACAGCTGAAGACACAATGGCGACCAACCAACTCAGCACCATTTT
CCAGTGAAGGAAGTCTGTTGTCCTTGTGAACCGACTACATGTTCCAGAGCAGCTTCAACAAATTCGTGCCCAAAACTTTTTTACGGAAAAATCTGGTCAC
TTTCAACACTTTTGATTCCTTGTTTACCTCTCATATGAACGGCGATTCCATGAACACTTACGTGTTTCTTTCTTTGGCGTTGTCATCCTCACGCTTGTGG
GAAGATCAGCCCTTTGTCTGCTGCTGCATCAAGGCGCAGAACTCTTCGTAGTCGATTTTGCCGTCCTCATTCTTGTCAGCAGCTTGCAGGATCTTGTAGA
TTTCGTCACGGCTGATGTGCTTGTTGCCCAGCACATGAAGAATGTGCTCAAGTTCGCTGCTCGAAATAAACCCATCACGGTTCACGTCGAAAGCCTGGGG
GAGACATATTGGGCGCAAGCTTAGCTCATTTGAGTAAAATGAAAACAAAACATTTGGCAGATACGTACGTCGAAAGCAGCTTTGAGATCTCCGGGCGTCA
GATCGCCTCTGCAGAAAACAAGATCATCAGAAATGCCCTGTCATAAAGACGCTGACGCCTTGGCCACGTACCGGCGGAAGAGCCTCTGATTCATCATGCA
CACAAACTCAGTGAACGATATCTTGCCGTCGCCGTCAGTGTCTGCTTGACGCATAATGCTGTCGATCTCCGAGCTGGTTCAATGAAAAACAGGTTAGTCG
ACGTTTAGACTGCAAACAATAGCAAACGAATACGCACCCCGAGAGTTGTTGACCAAGAGCTAATAGCATGCCTCGAAGCTCGTCTCGATCGATACAGCCG
GATTCGTCTTTGTCGAACAGAGCGAACGTCTCTTTGAACATGTCCATATTAACAGTCGACGTGCGGTGCGATACTAGGCGCTTTTCGTTTGCATCGGGGC
TGTCACCCAGTTTCGCGTGCTGTACGCCCATGATGACTGCCAAAATATTGGCACGAAGTTGTTGGAGACGCTGATACGATTGTAATCGCTGGGTATGTCC
ACTGTCAAGAGGGTCCTCAGGCGATGTGATACCACTGAGCCACGGGTGTTGCAGCGCTTGTTTCGCTGTCAATCGTTTGGACGGATCCGAGTCTAGCAAC
CGCGTTAAGAAATCCTTGGCATCTGCAGAAAGACTTCTGAACCACTTGTTCTCCACTGCATGTGATGAATTAGTTACTCATAAAGCGTGAGCGTTTAGCC
ACATACACACAAAGATGTGAAGGAACGTACCATCGTAGGCTCCTTTTGCAATCTCTTTCACGATTTCGGCGTCCGACTTGTCACCTCTCGGATCAAACGG
ATGTACTCCCGTTAACGTGATGTAGGCCTAGCACAGTATTGCGATCAGTCAAGGAAACGACACATCTTTTTTACCTCAGTTCGTACCAGCACACCAAATG
CCCACATGTCGACACCAAAGTCTTGCGGATGGCTCGTGATGATTTCAGGAGCCCAGTACGCGCTACATATGCACAGATTTAGTATCCCACAAAACTGTAG
CTTGCATATCGGCTAGCATACTTACACAGTTCCGTTTGGAAACTTCTCGATTACTTGCTCTCCCTGGCGAAGACGACGACTTAATCCAAAGTCCTGTCAT
TCAAAGGGAATGTCATTAATAAAACAAAGTTTTTCTGGAGCAATGACGCATTCTTACCGCTACTTTGATGTTTGCATCGGCGGATCGGTTTGAGAGCAAA
ACATTTTCAGGTTTCATGTCGCGGTGGCTAACACAAGCGATAAGCGTTTATTGAAGTCGAGAAAAAAATGTTCATCTAATGTAAGAAAACTCACCAGACA
CCGCGAGAATGCACGTAGTCGAGCCCCCGACAGACATCATGAAGTAGGCGAGCGGCATCCTTCTCTGATACTGACCCCTGGTGTCAAAATATGACATTAG
CAACTGCATCAACCGTATCTGCAGCAAAAGCAAAAGCACCAACCATATCAACAATGTAGTCGAAAAGCTCGCCTCCTTCAACCAAGTCCGTCAGCATAAT
CGTCTCATCTTTAAGATAGAGCACATCATGCAGCGACACGATATTTCGATGTGTACCAAGGTGCTTCAGGATATCAATCTACTGGCACCAGCCAGCAGTC
CCAACTCAGGATCATTGACCACCACCAGCAAACAAACAGCAAATAGCAACGTACCTCTGCCTGAATTGTCTCCAACGACGAACTCTTCGGATCGAAAATC
TTCGCTGCCAGTTTCTACCAAAGCCAAACCCGCAATAAACTTATCAGCTACTGAATCCCCAAAAGCCCCCACCTCATAAGTTTACCTGCTCTGTCTGGAT
GTCAATGGCAAGCCGAACAACCGAAAACCCTTGACATCATCAGCCAGATGATAGAAATTACTATTTCAACACTCCTCCAACCCCCTCAACCACTTCTCCC
CACCTCCTCGTCCCAGCTCCTTCAACAATGCGTAGTGTCCGCGCTGCTCCACCTTGGGGCTCGTCCACCAGGATTCTCCGCTCGACCCGCACTCGACGTC
GCTGCTGTGCGTATCCCGATACATCAGCGCCGCGATGCCCAGCGCCGTCGCAGTCGTCACGAAGCCGACCCAGGCCGTCCCATTGCCGTACGCAGCCTCC
TTGGGCTTGACAACAGGCAGATGCTCGACTGCCGATGTGGGCGCCACCTTGGAGCGCACCGGGGCGCGCGTAAGGCGCGTGATCAGCCGCATCCGCATGT
CTTCGTTGGGTGCAGAACACAACTGCAGCAGATAAGCATTGAAGTGGTACAGTGCT