Description :
From Genome Similarity Track
Location :
Scaffold_9:389255- 390959
Sequence
1704 bases(100 bases per row)
cagctcccgccgagttttcttgcgctttcctgcgttctgaccgggccggcgcagcgcaacgcgtttcccccagttagttggaatgttctgcttgccccga
agtcttggagccagatttagaaccaggtcttcgttgaagtcgcggtgggtcttgttacacagccaacattttgcgtcgtcacaggaacaacgctcgcaga
aatatgtcttggcaaaggacttcttttgctccgtccgtaagagagcgcagaccttgcacgtccgttgacggccatccagtcttctgactgctgaagggcg
tgggtcagacgaacgggcgtccgcccgtgcctttggctgggtggagatggtgtaagtagattccagcgaagtcctcagccttgagctgcaaaagctggtt
ctgaaggaccgcaaaccactcagaccttggcatggcggccgcgtacttggtcgtcgcccctctttgtggctcaggaatgcgttcactagcgggaggtcaa
agaaccccgagaatagccccactagtacttagtgaagcgcgtggacatttgcgaagagtaactttggaggcggagtcgattatggcgatccactccgccc
atccagttctgtagtgtttcgcagactcagggcaacctacttgcaatgagccgacgctgtcatgacagagcctgtgcacaagtagtactcaggcttccgg
tcccatcaaaggcatgaaattatgttaggaacggcgactgcgcgcgagaagaggaacaagccatggggactacttgctggacgcgtcttgcgcttggaca
cgatgaccttgttgaaccccatacggtacgtctgcactgtcctaccacgtacacgttcatcttcagcagctcctcagaaagaaggaccgaagaataaaac
ctgtataccacgactgcatgccaggtgtggcgcgactcagctgtgaaagcagccgacacgttccgaaatacggcagcggccccagtgttgatgtcaattc
taccgtcgatgtcatcccgctcgcccacgtagacttcaaatctagaactaaaaggttgctcgtatgtgccacaagcgtaagttacgacattaaaaataaa
aaaaatacttgtaaactcaatacgctttccttcgtcacaaagcataaaaagttttgagccattaacagtgaggcttgtccgacatgaacatgcgactggg
attgcgcctcgacgtggcaggaagaactccttcatcaaatgaaaagatggctggtagggactaacctgataggaatcgttcttgaatcttgtccactaca
ggacgcagcttccacatcttgtcgcggccatgctctacggtattgtctagatagtgaaggtcgcgcagaaggttgttgcagtgatcgcggttcatgtaca
tcctgaagaggccagctggtatggcgccgtcctcgaccatggaccagtgcgcagcaaagatcatttttggggacacatcattcgctccacaagaagccca
actacatatagaatttcgtgtgccccgaaaacttgcgctgccctcaagcgacgagcgatttgtattgcggtctcccgctggccccggactgatgcgcagc
catcttttcagctcacctcttcgcttgcagactgtaacgagtggtctcagcggcgatcgagacccagggagattttggatcgaagtagaggagcgtcagg
agtg