Description :
From Genome Similarity Track
Location :
Scaffold_13:38912- 44051
Transcript NameFunction/comments
Hyaar_Emoy2802408hypothetical protein
Hyaar_Emoy2900067HaRxL74

Sequence
5139 bases(100 bases per row)
ACTCGATGGACCTCATATCCAAATCGGTCTCACGCAAGCCACTAAATACTGCAATCCTCCATCTCTGTCGTCCACTGACCACACCTACCGTCTGCTAGAA
TGAAAAAGTACGTCGTTCTCCTCGTGTCTACGCTCCTCGTGTCTTCTGGTAGGGGTGCCTTATCGATTCCAACAGCCGATAAGCTGATTAAGCGCACGAC
GTCGAACCTGCCCCCAGTCACTCCGCCTGAGATAAGCATGAAACGAATGCTCCGAGGGGCCGATAGAGGAATTGCAGATGCTTCCACCTTCAGCTTTCTA
AAGCCAGTTATATACTGGTTGAAAAAAAAGAAAGATGCGATTGTTACAGGGTCGACAAACGCGATCAAGAATCTCGAGGAGGAAGATCGCGTCACAGTCG
CACAACGAAGTTCGTGATACGAACAAGATTTTTGATGAGCAGCACATAATTTTCAACTTTCTCGTCCATGATGCCCCCCCGGTCCTCTACGACGAGAACC
TACTTTACCGCCATCCAGGAAATAGAAACAAAAACGTACGTGCAACCAGCTCCAAAACGTACAAGGAGAAGTATAAATTAAAACACCCCAGCATTACAGA
TGAAGCAGTAGCATCGCCGTAAGGAAGGGTCCGAACCGTACATGCTACAAAGAGGACATACACACGGAGCAGTAAAGGCCGTCTGAGATTTTGTGGGCTT
AGATAGCAACATAAACTTTGAATGATACATTTTCTCTATGGTAGTTGCGCTGTCCGTCCCATTCGTACATATACGTAGGAGCCCCATTCTCTTGGTTTTC
TACGGTTTTAACACGCACGGTATCGGATGGAGTCACTCATATCCGATAGATGTAAAAGTGCCACGTCTAGCTCTATTCAACAAGTCGATGCGTATCACAT
CCACGAGTGTTGGAAGTAACGGAGGACCAAGAAATTAACCACGTGCAACTGTAATGGGTACAACAAATCATTATAATGTGATATCATAGTGCACGGCAAT
GATAATTCTTGATTTAATCTGTTTGCATCATATTTAAGAACACGTCCGCTCAGTATCGGTGGCTAGCAATGTCGGTATGACACTTTATATCAGGAAGGCC
TTTGTGCAACTCTGCTTGATACATGAAACGGTATGTAAAACCGCATTTGAAGACCACGCACCTCGCTGCGTATTTCGCCAAGGAATCCGAGCACGTCATA
GAAATTTCAAGCTTAGCTTTTGATCATTTTCATCAATCTACCACTTTAATGTACGAATCTCACTGCAGCTTCCTCATCATGTTTCATTTGTATTGCTTAC
AGCTTGCATTGAATGAATATGGCAACTGCGTAAGCCGTGGTGGTATACATTGACACGAGCATTTCATATTGAGCCTCCTTGTTGCTAACACACTTCTACG
CGTGAACATGTTGACCGAAATTCAGTAAAACTTGCGAGCAATGTACGTGTACTTGTTACCCTTGTCAACCTAACCCTTTGGCTCACCATAGTGGCACCAA
ACGATCAGTTATGTGGTTGTTGTGCATAATGACAAATAAAATGTCAGCGCTCTTTCTCGTTCCACGATCACTGGTAAATTAGAGGACTTATCAGAACATT
TGCTGTATTTTGTGCGGGTCACGTGGATCTGGTATCTTAAGCGTGACACACGTAGGAGATACAATACCGTAAAGTCGACTTAAGTCGCGACAACCTGTTC
ACACCTGATTTATTGGAATGCGCTTTGTGTTAGGTCTAACCTTATTCTTAGCTTTGCTCTAAAAAAAGAATCTTTTATTTTGGTAGTAGAAGCGTTCATC
GCTTCAAGACTCGACTATCTTCAAAACTTGGTAGGTACTTATCACAGATTCGTGTCGTCAGCATCGTAAAAATCGTGCGACGAGTTCTGTCGAAAAATCG
TTACCACTCCATCTCGACAGAAGAATACTTTCACGTCATTTTGTCAGCGGAAGTTGGTGGAATCTGTATATATTTTTCTGGCATAGTCCACGCATCTGAT
TATGATCTATTTTTCGTCATGCGGACTTTCGACACGAAGTCAGTCGATTGCATCAACGTACAAAACCTTTACTGATTGCTACTGTTTAAAATTGCTATAG
CTAGTCCTGCTCGAGTCGATCCAACATGAATGAAGTCATCATAAATTACGATCTTGCTGATCGCACGTGAAAAAATAACTTTGGTGACGGGTATACAGAT
TCTATGCCCTCAATCATGCTGATTTTATAGTGAATGCAGAATGGTAATTTCTCGACCACAATGAAGAAAACTCTCGAACGAAGTTTATTGTAAATGCTAG
TTTTTACAAAAAGCTACACCCGCTCAATTCAACTTGTACGATGATGTCATCTGAAATTTGTAGTACTAAAATGACATTGTCGGCGACTGCGCCGCAGATT
CAGGTGCACAAAATAAGTGTAATTCGATACTGCTGATTCTCTTACCCATCTCACTTACATCATGAGCAGTTTCATACGTACGATAAAACACACGAGCAGC
ATTACCTCGTTTTCCTTTACCGCATCATAATAGTCAGTCCTAATGTGTCTAAAAAAATTGTCTTCACTTCCAAGTGTAAAGTAAACGAAGATCGCAAATT
TGCACTCATTATCCCCATTTTTATTCATTCTCGCGTGTCCTTCAAAATCACCATTTTACGCCTCAATCAGGTCACTCAGCGCGCATCAGCTTACGCATCT
GTTGAATCTTTTTGTGCTGAGAAAGGTGGAGATCATGCACATTTGATGAGAGCATGTGAATCACCAGCTCACTCGTCCACGTTTAGCTTTGAAAAGTACA
CTACGATTTGTGGCAAAAGAATTCACGGAGATAGCTGGGCACCGATTCTTAAACGGTTTTTGGTAGCACGTTATAATTAGCACTACGTGGTAATTGGCTG
CATCAAATACTCGCTTCACATACACCAACAAAATCAACGCTATCTTAGGCCATAACTTTGCATCCTCTTACAATAGCGTTGTTTTCTGGGTTAAGCTCTG
ACCAAAAAGACACCATTCGATAAAGTTTGTAAGGACGAAGATGGGTCTTGACAAAATGTCATTTTGGCGAGCGTCCTGGAGCTGGACGATGTGAAATTGA
GACGCAAGGATGCGGCATTTGCATCAACTATCAAACGTATATACTGCCTATTTACTTACTCAGAAAATGAACTTAACTTGGTTCATTCAACGGTGCCCTT
AAACGATTAAGCGCTGGACGGGGTACGTGAAAATGAATCAGCTGTTCATTAACGATCCTAGGTGTACCATGTTGATACAATAAAGTTCACGAAGGGTGCG
AAGGTCGAACAGTGCAGCTTATATAGCGAAGGTGATAACAAGTTATTAGTTAATCGCATCAACACTTTCGATCGTAAATCAGCTCCAATCCTACCTTACT
AACAAGGTAGAACGCTTCCGCCTTATTAGCAGCATCGTCGACTGGTATTGTGTGTAACGAGGTGAGTCCGTTTCATGATGTAACATGCAAGACAATTCCA
TGGCACTATTATCGTAGCTAGAAAGATTAGCATATCTACCGTAGCCGATGGCTTCTAGAAGTATGCATTGGCATAAATCTCCCGATCGTACGAGATGCAG
ACCGCCACTTGACAAACGTTTACTTTCTACCTGGCGTGTCTTATATTCGCCGTCACCATCGCCATGCCTGCTTTTCGGTCTCTTTCATATAGCGAGTATA
GACCTTAAGTGTAGCTCCTCCGACCTTGTTCCTGTCGCTACATACGCTCGAAAAGATTTAGCCATGTACCGAACAGTGTTACCTTTGTAACTTCATTCAG
GTCATTCTCGGGTCATGTCGTTGAGCGTACACAGCGTGGCCGAAAGTCCGGTCATCTAATACGATTTTTGGAGGTGCGTTGAGTCCTGCTGACCTCGGAA
GGCGTTTACAACGATTTCAATGTTGATGGCGGCATAAGCGGGAGCAGACGACACCAGTAAGAATCCAGTCATTGCAAGGAACGTAGGCATCACTAGAACT
TGCAACCTGCGACTTTTACAACGTATGACGCTGGTCAGGATATGTTTTTTATGAACGAGAGAGTACGTGAGCGATATGTAGATATATACAGAGATGTATA
CATGCATAACCTGCCAATAGTTGCTGACCTAAAGCAAGACGGCGTGCCGCTTTCAAGTAGATTGGCTGATAATGCAAGAATGTCTGGACATGTTGGTATT
CGAAAAGTGTCAGTAGCAAAGCGATGAAACGGGAATGTGGTAGATAGAAAATAAGTAAAATTCAGACGTCGCTTTCGACGTTGTCGACCAATGTCGATCT
TGTGCTTCGACTCTTCTTCCGGTCATGCATACTACTAAGCACCCTCAGTCACACATTCTTACCTGCTCGATCAAATCGCTAGCTGTTCGCGAGCTTGTGA
TATTGAAGATATAAAATGGGTGTTACAAGCAGGTTTCAACTTTCGATTGAGCTCCAATTGACGTGAATCTATCGTCGTGTATGTACAAGTGGTGAGGATG
TCACGCAAAAAGTTTAGCTTTGTAATGCGAATTGGAATCGGGTCCGTAGCGATGCACCTATTGCAAATGCACGTGAGAGAACGCTGACTACTGTTTCATC
TACAGGTACTACATGCAAAGCAAGTATCACGGTCAATGCGAATGCTTTGCGTTTGACGTTGAATCGAGGCGTTTCGAGAAGTACGGTGATTGACATAAAG
ACACACTAATCATTTATTAGAGCCACGATACAACTTCAATCGAATGTATTGTGTGGCCAAACCAGTCCACATCATTATTTTTTTGATAGATTTGCTGGTA
TAAAAGACAGCGAAGTTGGAAGGGTGGTGCAGCAGAAAGCTAATACTCTACGCAGCTTTTCTTGACCAACACGAGTTGACACATTTATGTACTCGCATCG
TTTGTCAACTCGTCTCAGATCCTTACACCGTAACACATAAAAACCTATTTTTGATATAAAGTTTATTGAGCTTATACTGCATTCGTGTACACGCGATACT
TACCAGGTCAACACTGCCCGGATGAACCCGTGCAACTTACACAAACTGACGGGATATAGTCGCTCAAGTTTGATGAGGAGCCTTGGTCCAGACTATAAGG
AGCTGTTGGCCTGCCTCGCGCTGGCGACTACCGTAGGCT