Description :
From Genome Similarity Track
Location :
Scaffold_7:3891- 9642
Sequence
5751 bases(100 bases per row)
GCGTTGGGGTGCAAGCTGAGCGTACGGACAATCTTGCCGAAGGGTACCTCAAACTTCCATGAGTTTTCAGACTCAGGGTATCCACGCCACGCCACGCCAC
TTCACCAGATACTGGTATTGAACTTTGTGGCGACGCTGCTTCAGAAGTCTCTCCACATGGAACTGCAAGTTCCCTTGCTCGTCGAGCAGCGCAAGAGGTG
ATCCATGTGTCGGCACAGGCTCATGGAGACTTAGTGTCAGAGTTGAAGCGACTCCAAGCGTCTTTCTTCACGTGCAGACGTCGCTGGATCAGTCTGTGAC
TGAGAGGAAGCAACTTCGGGAGAACCTTGACCAAGTACAACGCGCTCATGAACAGTCATCGACTGAGTTGGCTCAGTTTTGTGAGCAGATGAACTGTCTC
AATTTGATTGACTCGGTCGACAAGCGACTGAGGAAGGTGGAGTACAACCTGCCACGGCTGGATGGCCAGGTGGAGCTCTTGACGAAGATGCAGCTAGCGG
GGAAGACGTCCCTCCTTCAGGCGCAAGCGCCTTCTGGTCCACGAGAGAAGGATCATGATATGTCTTAAGCAAGCCAACGTAAAACACTGGGTGTGTGCGC
AACTTGCGCGGGAGATTGAGTGTATAGTCAAGGCCTTTTTCCGCGATGACCGCAAACGGCCCAATGAAGCGCGGATGCATCGTCTTAAGGACGGCAGAAA
ATACATTTGTAGGTAGATTTTTAGCATTTAGTAAGACTTGGTCTCCAACTTCATAGGAGTCAATACATCCACTGCCTTTAGCATCAGTTCGTTCTTTTTA
TTCGTCTTGGCTATCATCCATTGTATCACGCACATGTCGTAAGACACTAAAGCGCGTCGTGAGAAACTCGCTCACTTGTTTCTGCATAGTGGTAGGGCTG
ATGTCAGCAAGCTTGTCAGCAGACTGTCCCCCACCAACGGGGGGGAGTCTGCACGGAGTGGTAACGTGAGCGGAATGAGGGGGTGCGTGAAACTATTCAC
ATAGAAGGGATTAAAGCCGGTCGAGGCATGAACAGCGTTGTTCAACGCACACTCAATGACAGGGAGCATCGAGCTCCACGTCTTAGGCAACTCAGCACAA
ACACTGCGAAGAACGTCGCCAATGACGCGATTAACTCGCTCAGTATGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAATCGCGTACCAAGTA
ACTTGAAGATAGAAGTCCAAAACTTGCCTGTGAAGCGAGGGTCGCGATCAGAGATGATTGCTAGCGGCGACCCGTGTTGACGAAACACACGATCGATAAA
CAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACCGCCGCTAAGTAAGCCATTTTGCTTAAATGGTCAAAAAAGACCACAATTCCCGTATTGCCG
TCACAGTCTTTGGGAAGGCCAAACAAAAAATCCATACTGATGGACTCCTAACACCCCGTGGGCACAGGTAAACTGGCGAGAGGCGCAGCCGAATGTTCTG
AGGGTTTGACCCGCTGGCACGTTTCGCATGCACGCAAGTATGTGCTCACCCATTTGTAGATTTTGGGCCACCAGTCGTGTCGACTCACAGATCCATAAGT
CTTTTCCCGGCCCAAATTCCCCCTGCGGGCCGTATCGTGGTCCTCAAAGAGAATTCGGTTCTTTAAATCCTCATTGTGAGGCACAACAATGCGAGCGGTA
TCCGCTACATCTGTGCGATAGCAGAAGAGGCCATCATCGATGGAATATCGATGCAGGCTGGCCTGCAAGCGTGCCGATAATTGACTGTCAGAGTCCTTGT
ATTCCTCACTCCCAAGGGCATGAAACAATGCCACATATTGAGGACCCCTGAATAGTCCACACGAATTAGCTCCTCAATAGGAGACGACAAAGTCGTGGCA
TGAGCAAGCTCACAATCAAGTCGGAGAGAGCGAGCATCTGCCAACACATTTTGTTTGCCTGGATTATACTTCACCTCGAAGTTATATTCCGCAAAGAACA
AAAGCCAACGAGCCATTCTATGAAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGATGCATGATACGTATAGACGACGAATGGCTTGGATCCAAGTAGA
TGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATGGTTCTTTTCAGCAGCTTTCAGCTGACGTGATTCAATGG
CGATAACTAGAGAGCGGCCTGCAGCATCTGTTTGTATTAGAGCGCTGCCAATGGCAAAGTCGGAAGTATTGCAGACAACACTGAAAGGGTGCTCAGGATT
TGGCAACGCCAAAATGGGAGCATGGAGGAGACTCTCCTTTATTGCTCGAAATGCGTCGGCACGGGTGTTGTCCCAGCGCCAATCGGTGTCCCTCTTAACG
AGATCATTTAATGGCTGGGCCATATCAGCGTAATTTTCACTGTATCTGTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCCTTTTGATTCTTAT
GAATCATCCAGTCTATGGCTTTGACCTAAGCGGGACCCGCTCGAAGGCCGCGCTTACCAATGAAACATCCTAGAAAAGGAATATCCCCTGAACCAAAAAT
ACATTTAGACGCGTTGGCGTACGGTTTATTAGTGCGCATGTACTCGAGCACGGCTCGCAAATGACCGATATGATTTTCAACATCTGACCGACCTTTTTCG
GCACGAACATTGACAAAAATGTCATCAAAGTCCGTGCGTAATCCCGATATGGGCGGAAAACTTGCGTCGCCAGACGATTAAATGTTGCCAGAGCATTATA
CAGCTCTTGGGGCATCACCAGCCATTCCCATCGCATAACACTCGGAGTGCTCACTGCTGCAAGCGGAATGTCACTCACTCGCATGAGCAATTGATAATAT
CCATCAGCCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTGTTTTGAAGAACATCCTTTCGAGGAATGGGTTTCAATGTCGGAATATTAGCCA
CATTAAGCTTGTTATAAGCATGCTCAATACGCCACTTGCCGTTAGGCTTTTTGACACAAAATGTCAGTGTCGAATGTGGAGATTTACTCTCACGAACCAT
TCCTGCCTCGTGCTTAGCACGGAAGAAGTCATCAATGACATCACATTGCTTCTTAGTCAAGGGCTACTGTCGTGTGACATAGTATTTAGTCCCAGGAACT
AAGTCAATTTCATGACGGACACCTCTATCTGGAGGTAGAACCGAGGGTGGATCGTGGCACACCATATCTTGAAATTCCTTGACTAAGAATAAAAGGGATC
ATGAGGGTCTTTCAATATTGATGACCCACTACGCGCACTGAGTGCTGCTTTTGTGTCCTCCAGAACGGCTTCATCCAAAAGTGAAGAAGAGTGCAACTAT
ATGATGTCGGGTCGAATGACCACCACCTCTGAAATGTCACCACTCTTTAGTGAGTGATCAAACTCATCGACCGAAAACTTTTCGAGTTCTAAAAGCGAAC
TTAACGAGGGTATAGCCTCAAGGATAGTTATACCATCACAGGCACCAGTCACTCCATTGACGAGTGTATACAGCTGACAGTCATCATCACTTTGTGACAC
AGCACACGATGTGTGATTCGTATCTCTCTGATCGATACCATCGCCAAACTTAATTTTCTCTAAACTAGAACTGACGTCACTGTTGACATCCGATGACGAG
TCATTGGACATGACGTCGTTATCACGTGGATTACGTGCCACTTTACGTGCTGATCCGGGCTCGGGATGCCTTGGTATTTCACCAAAAATATCAATATTGA
CATTCAGCGCGCCGCTATCACAGTCAACGTCACTCAGTAGGTACTTCGTGCCACTCCACACTCATATGACGGGTTCAACCCTCTATGACTTGACGCTTGG
TCAACAATGCTTTCAGCATTCAGTACGTTGCTCTCACAATGACTATCACTTAGTGGAGTACATGCCGCTTCACTATCACATATCGAGCTTTGCTCTATAC
TCATGTCTTTGACATCTTCAGAATCAACTAACTCTGACATTCCGATGTACAGCACTGACATTTTCATCCAGTGGCTCGCGCCAATAACGCTTCTGATTCC
TAGCAGAGGTGGGTTCATGACTATCCAAAACTCTGCTAGGAGCAGTGCGCGTGGCGCCTACTGCATTCGACCTCCAGTCGATCCATGACTCATGGCGCTC
AAGCCAAGCCATACCAAGAATGAGATCATATCTCGAGTCTAAATAAAATCAAGGACTAAACAGCGTTCAATACTATTAAAATCAAAAAACTTGACACCCA
AGTTCGCAGAAACTTTGGGTGCAGTGACTAGAGTTCCTATGCCAAGTGAACAGTGATCGTATCACCCTTGTGCGCTTTTAGCGCCTCAACATACTGTGGA
TTCTCTTCAAGGGAACAGCGTCTGACATAATTACCGGATGCTCCGGAGTCGATCAAAATCGACCAGGGTTTGTCAAAGCACTAAACAGTCGCCCTTTTGA
CCAACAAGCCTGTCTTGTATTCACGTCCCGTGCTAGAGTGAACGGGACTCCTTGGGGCTAAATTCTGCTCGCCACTGCCTCCTATAGGCTCAATAGAATA
TAGTTCTTCCCCAGCAGAGCGCCCAGCGCCTACTGGGAGTCTACGTTTTCCCGCACCGTACTAGACTTCTGGTTAGCGGCGGGAGTTCGGCATGAAGTAG
TATGGCGTGCCCTGCGTAAAAGGCAATTAGGTCGCATTACTTTGTGCTTCCGCACGTGAGACATCGTGATGCTGTTCTACAGATTGAAGCTCTGCTTCTT
CGTCTGTCTTGGCGAGACTGAGGTCCATAGGCTCCAGCCTATTAAATGAAACTAAAGGAGTTCGCCGAGTTTGGGTTGTACCCATGGGTGCCAAAACTAG
CTGCCTTAAAGTTGAACTCAGCGCGATATCAACAGCCGCCTCAAAGGAGGTGAGGTGTACCCGGGATACTTCCATTTGAGCCACGCCCGTGCGAAGGCCC
TCCATGAAGATGGTAACCAAAACCATTTCTGGTAAGAGATCAAGCTGCATGGCAGCTATTAGAGTTCTCAGTTCCTGGACATAGTCCAATAGTTCTTTCT
TGCTCTGACGGGCAGATAAGAAACGAGAACTCACTCGGTATGCCTGATTAGGCGGAGCAAACACTCCAGATATTTGCTGTTTTAGCAAATCCCATGGGGA
GAAGGCTTCGTCTACCGACGTGATACACGTGAGAGCCCATTCTCTGGCTCGACCACCTAGTTTCGAGATAGCACTCCCAACTCGCTGTTGCTCTGACCGG
AGTATAGTGGAGGTCATGGCCATTTCCACCTCTCTGATCCACAGGAGGAGATTCTCCCCTTCTTTTCCCTCAAATCTCTTTACAGTCACAAGAGGGCGAG
CCCTTGGATCTTCATCGGGTACGAGGACATACCGAGTAGGCATAGCCGATGTCAAATGGTCGTGTTATTGCCCATTCAAAGTGGAATCAAACTGAATAAA
AGTGTCAAGGCGTGCACGAATCACGTCAGGACCTTGTGCGAGGATTAGATCCACTTGTTCGTTCCCGACTAGCGCTATGAGTTTCTCTAGCGCTAATCCT
TGGGCCTCAAAGAGTGTCATCTTTGTTTACATCCTTATACAGGAGCAGTCTTTAACAGGCTCAGGTGTAGATTGACTACGAGTGCTACCAAGTGTAGCGG
AGCTACCCTTACTCCTATGTCAGAGGTAGACTTCTATGCTCGTAGAGTCTC