Description :
From Genome Similarity Track
Location :
Scaffold_2020:3891- 5904
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2020-snap-gene-0.4Conserved oligomeric Golgi complex subunit 8

Sequence
2013 bases(100 bases per row)
GTGGTCGAGGACGTGACAGGAAACAGGCGTTGGAAGCAACGCGCAATGTACGGTAACAGCTCTTTGGCGAGGACCTGGGCCATCCAAAAAAGCACATTTC
TCGTTAGCAAAACTGAAGAGCTCCGAAAGAGAGCGACCAGTTCCGTACCTCATTCATGTCACGGATCGCGTCCGCCAGCGCTGCCGCCTTGGTCGGTCGA
GTCCCGTTCTCACTGGCGCTGTCATTCGTCGTCGTGGGAGGTGCCAGCGCGAGTCGGTTCTCTTGCACAAAAGCGCTAATGATGCCCACGACTGCAGCGA
GCGTGAGCTGCAGGCGCTTTGCGAGCCGCGTCTCCACCGACACGATCGTGCAGAGCCGCAGCTCATTGAACGATGAGAGTAGCGCGTTGGTCAGCTCAGC
GAGGATCGGAAACGACATGAGTACGCGAGGCGGCGAGAAGTCGTGGTCGCCATTATGGGCCGCAAACGGTGTCGCCTGTGTGGTGCTGCTATTGGCTAGT
GCATGGCGATACGATGCCAGAACAATTGGGGTTTTGGAGCCAGCAGCAGCTGATCCGCTGCCGCCACTCAGCGCGTGGGCGCCGAGACTGCTTTCAAAGT
CTTGACATGCCGCTTCCCAGCTGCTAGCCATGAGGTCCACGACGTGGTCTTCAAAGTACACGACAAGCACAGCGCGAAAGTCGACGCCGACGCGGCCGAG
CGAGCCGCCAAAGAAGAGGCTCTGCTCGAGCACGGTCGCGAGCGAGCTAAAGTCGTCGATCTTGGGCAGTTGGCTAGTGCAACACGACCGTCGGAATTAG
TAGGAACGCATTTTGCGAATAGCGTGGAGGGGAAATCCTTACCGCATGAGGATCTGGATAAAGTCGGCGACCGTCGTGGTCGCCCACCGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGACGTTCTCACTGCCAAAGATGGCCGAGTACTGCGTGATCATGTCGAACCAGCTCGTGCGTTTGATGTC
AATCAGTTGAATGGTCTACTCATGAACCACGTCTCTGTTATCCCCCTCCCAGCAACGGTCCCCTATAAACAGTACGTACGAATTGGTACGCGTCCGTTGT
CGGAATGCTTCGCGCCAGGGAGGCGAGCCACGCGGTGCGGCACCGCAGGAACTCCTCCTTGAGCTGCCGCTCGTACTCGGGCGTGCCCACAGTCCCACGC
GCGTTGGATCCCAGCGTGTCGAGCCGTCGCAGGAAGCCCACGACGCGTACGCACACGGCGAGCGGCAGATCTTCTCGGAGCTTTTGCAGCAGCTTATCCC
GCAGCAGCGTCGTCATCTGGGACACCTCGCGCGCCTATGGAGAGACCAATGGATTGTGAGACGTTAGTGGAAAGCTCAACTAGGAGAGAGACGTGGCGGC
TTCGTACGAGAGCTTCAATCACGAAATTCGTTTCGCTAGTCGTGGTACCCTGGTCTTGGAATGTGTCCCTCGCAAACTGGATCACGTCGAGCGCGGAATC
AAAGAGCTCATTGTGGATACACGCTTCGAGCAGCTGCGGGATCTCGAGCAGCTCCGTCAACTAGCACAACTCCGTATTAGCTCCTGTTCTGTTTTGATAG
TCGTATCTTCACGCAGCCAACACCCACCTGCATGTAGTGGTCAAATACAAACTGAATGTCGCTGTGCTGCGCCACGATCGCCTCGGTGTCCTCTTGGACG
CCGGCGCAGAACGCCTTGAGCTCTGGGATCGCGACCATGATCTGCTCTGTGCGGTCCTTCAGCTCAGTGAGCTAGAGGCACAGCACTCAGGCGGCGTCAG
ACAAAAGGGGATAGGAGATCACTGCTTCAATCCACCGACCTCGTCCTTGACAATGTTGGCGCTTTGGTTGCTCTGGATAAACACGCGGTAGTTGCGCAGC
ACGAGCGCGCGTAGCTGCTCGGCGGCCGTGTCCGCCTGGATCTGCAGGCGCCACGGCTCCTTCTTGAGCTCCTCCAGCGAGCCGGCCCGCAGCGCCGCTG
GTGCCGCCATGGT