Description :
From Genome Similarity Track
Location :
Scaffold_48:389060- 394594
Sequence
5534 bases(100 bases per row)
GTACCGCTTGAGTCGCCCGACGTAAAACGTCGGGTGGAGTCTAAGTGACGACGGGATGTCCAAGGTGTACGCGTCGCCCACAGCCTTGGTTACACGAAAA
GGACCGATAAAGCGTGGGGCAAGTTTGTTGGCGCCGAGGTTGGTCACGGCGGAAGCGCGGATTCCCTCGGTCGATAGGAGAACGCGATCTCCTATCTTGA
ATACATTCACGTTCTTTCGACCGTGCTTATCAGCTTGTTCCTTTTGCTTGCCCACTGCGTTCTGCAGTGCGTCGCGGACGAACCTTGCGATGGATTGCCT
TTGCATGACGAATTCCGCAACTGCCGAGCGATCGGTAGGAAGCACCGAGAATTTCGGTGTATAGTTTGCCGTGGTAACTTCTTGCTCACGAATCTTGCTG
CCTGGATCGATCAAGTTCTCCGACGTCCATCTCGTTATCGGAGATGCAGTATGCCGAGGAGGCTCGATGGACTGTTTGGACGGAGAACGAGTCAGGGCGT
TCGCACTGGCTACACCCGAAGATAACCCTGAAGTCGAGTGCGCCGGCAGGCTTGTTGACACCGGTGAGGCTACCGGTGCGTGCTGAGACACCGGTTCACG
TACCGGTGATGACCACGACACGGACACGTTGTCCCTAGAGCTGAGCGCATCTTCAGCATCCATGTCGACCGAAGGAGGTTCTCCCCCACCAAGGGTGGAG
CCACCAGCATCCGTGGGTGACCCACGGCGAGAAGTGCCGGAACACGTGGGTGGCGAGCGTTGTTCACGAAGAACGGCGTCATACCCGTCGAGGAGTGCTC
GGCGTTGTTGAGTGCGAGCTCGGCTAGCGGTAGGAACGAGCTCCAGCTCGTGTACGAAGTTGCGTAGCTTCGGAGAACGTCCTCAAGGACGCGGTTGACG
CGTTCTGTTTGTCCATCCGTCTCCGGATGTGCCGCAGTTGACATCAGCAATTTGGTTCCCAAGAGCTCGAAGAGGCGTGACCAGAACGCGGATGTAAACC
GCGGGTCGCGGTCGGACACGATAGACTCCGGCAGGCCGTGGTGACGAAAAATCACGTCGACGAAGTGGGCCGCGGACTCTTCCGCGGTGATTGAGGCCGC
CACCGGAACGAGATGGACCATCTTGCTGAAACGATCAACGAACACAAGTACACTTGTGCGCCCGGCTGTATCGGGCGGAAGACCGAAGATGAAGTCCATC
GAAATGGAGCGCCAGGCTTCCGTGGCGACCGGAAGAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGTTTGACTCGCTGGCAAGTTTCACATGTGCGGA
CCCACTTGCGTACCCACTTGTACATGTGCGGCCAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCAAGATGTCCTCCAGTCGGGGCGTC
ATGATACTCGTGAATTATGCGCGCACGTAGATCAGCGTCGTTTGGGACGACGACTCGAGGATCATCGAACCTGTCGATGCTGTACTTGAGTAGATTACCG
TCCAGTCTATATAGATCGATCTGATTCCGCGTGGTCTTTGACAGGTTACTCAGCGTGTCACTACTAGGAGCACGCAGGTGCTTCATGATGGCGCCGTATA
TAGGGTCATCATCGTACGCTGTAGCAATCTCGTCGCCCAGCGGGAGCGTGGGCGTGGTCAACGTCAAGTTGATGCCTGACGACACGCAGACCGCACATTC
GTCGTCGTCCTCATCAGCGAGCTGATGTCCTAGCGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATGTTATTCTTGCCCGTC
TTGTAGTGAACAACGAAGTTGTACTCGGAGAAGAATGACAGCCAACGGGCCATCCGTTGCGACAAGTGAGGGCTCTTCATCGCTGTCCGCAGCGATGCGT
GATCAGTGTAAACCGCAAATGACTGTTCACCGAGCAGGTACACTCTGAATTTGATCAGAGCGTACCGCATTGCCAGGAGCTCCTTGTCGTGGACTGGGTA
ATTCTTCTCGGCTGGCTTCAGTTGGCGCGACTGATAGCTGATAACGCGTTCGTGTTCGTTATCATCGAACTGCATCAGCGCACAGCCGATGGCAAAATCG
CTCGCGTCGCAGACGACGTGGAATGGCTTTGAGTCATCAGCAAGCTTCAGTATCGGCGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTGGT
GGTCCGATTTCAACTCCCAGATCACGTCCTTCTTCAGCAGCGAGGACAGCGGCTGGATCAACCCAGCGTAAATCTTCGTGTACTTGTGCAAGTAATTGGC
CATGCCAAGCCACTGACGCAACTCAGTGGGGCTTGTCGGCGTTGGCCAAGCACAGATAGACGATACCTTCTCGGGATCCGCGCGCACACCGTTCTTGCTC
ACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTCA
GGTGTTTTAGATGTACGTCCACGGCACTGAGGTTGCCCTCAGCGCGGCTGTGCACGAAGATGTCGTCGAAGTAACTCGGCGCGAAGTCTCGAAGCGGGCG
AAGCACATGGGAGACCATGCGATTAAAGGTGGCAGGCGCGTTCTTGAGGCCCTGTGGCATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTACG
GCGGTGAGAGCCACATCAGATGTTCTCATCAGGATCTGATAGAATCCATCGGTCAGGTCGATGGCGCTGTAGATGACGCTGCCAGCCATGGAGTCCAGTA
CCATGTCCTTCCGAGGGATCGGAGTCTGCGCGGGGATAGTGGCATCATTCAACTTGTTGAATGCGTGAGCGATACGCCATCCCCCTGTAGCTTTCTTCAC
ACAGAACGTTGGACTGGAATGGGGAGAGGTACTCTCACGCACGTGACCCGCCTTTCGGCGGCCCTCGAAGAAGTCATCGATCGCTTTCACTTGATCACGA
GGAAGTGGCCATTGTCTGGTGACGCAGTACTTCGTACCTGGCGCGAGGTCGATCTCATGCTGAACCCCACGATCCGCCGGTAGCTCGGCGGGGATCTCAT
CCGGGAAGACGTCGGCGTACTCGCAGGCGGTGTCGTATACGGGATTCGCTGACTCACGCAAGGCCCTCCAGGACTGCGTTTGGAATCGTTCCTCTCGAGC
AGACTTAGGTTCAGCACCTAGCGGACGTGAACGTTCACTGTCCGTTGCGACCGCATTTGCTGCCTCATCCACCGAGACTGCCTCGGTGACCAAGCATACT
TGCTCGACGTCTCCAGCCTTGAGGTCCCGAAGAAAGCTCTTCCAGGACAAGCCTGGAAGGCGTGTGATCGCCGCCGCTTCGCGCGGCGGGATCGCGATTG
CGATGCTGCGCGACCGATTCGGGCCTCCTTCCACGTACTCCAGCGCGCTGACCGATTCCATCGGCGGGCTATCGCTGGTCGTGCAGTCTCGACGAGGTTT
CAGGCGTCGTCGCTTCGACTTCTTATTCGACTTCCTCGAGCTTACGCTCGAGTCTGACGCACTGCTACTCGACGATGCATCACCCTCCTCTAGGCGCGGG
AGACCGTACTCGACCGGGCCGGGAACACGCGGGAGCCCCTGCTCAACCGCGGCATCGTTTGACGGGAGCCCGATCTGCTCGACCGCCGAACCGTTCGGCG
GGAACCTCTGCTCTACCGCCGTCTCGTTGTGTGGGAGCCCCTGCTCGACCACTGTCTCGTGTTGTGGAAGTCCCTGCTCGACCACCGTCTTGTACTGTGG
GAGCCGCTGCTCAACCACCTCATCATCTACCTCGCGAAACCGCGAGGGCTCTTCGTTCAACAACGTAGCACAAGCCATGCAGAGAGGGCCATCGCTCGCT
CTGTGCACTGCTTGTGTCGTTGCTGTTTTGTCGACGACTGTGACGTGGGGCCAGTCTCTTGGCGCCACCAAGAGGTGTGTGAAGACCTCGCTCACGTCGA
ATCCACGTCGACGCTTGACTGATTGGGCCAGCCAGTCAATCTCTGGCTGATATCGCGCAAGCCAAGGGATGCCCAGGATGCAGTCAAACGCGTAGTTCAT
CTCGATCAGCAAGAAGTCGTCCTTGCTACGGAAGCCGTCGAACGTGTACGACAAAGACACGTCACGCCGCGCAACGCGGCGAGCCTTACCGTCTGCGAGT
TTGACTTGGATCTCGCCCGGACCATTCCGGACGCGGACGTTCTTGAGTAGTACCGACAAACACGACGCGCGAAAGAAGTTGTTGGTCGCTCCTGAGTCAA
GGAGCGCGCGCAGTGGTCGCCGGGCACCGGTGACGTGGAGGCTGACGATGATCAGTCTCGAGTCGCCCGGCGTAGTGGTAGCATTGGTGTGTGCTTGGAG
CACGGGAGGGCTCGAAGGTTGGGCTGCCACCGGAGGGCCCGGTCCTTCGTCAAAGCCAGTAGGGCGCCCCGCACCTACTGGTCCTGGTCGTTTTGTTAAT
GAGCGACCGAGGAGTGTTCCGCGTCGACGTGAGAGACGACGGGAGCTGGCGCGCGGCACTCCGCCGCGCGATGACCCTTCTTCCCACAACGGGAGCAAAT
GAGGGAGCGATTGCTTCGCCCAGAGCTGCCGCGGTAGGACACGCGACGTCGATTGCTCGACGCGTTGATGGCGTCGATCTCCATGGGCTCGGGGGTAGAC
TCCCGGGCTTCCGCAGGTATGGCTGCGGCGTACGATGCAGCTACCATGTAATCCTCGCGAATCGCGAGTGCAAACGCCTCCTCGAGAGAGGAGGGCTCAG
CTCTGGTGAGGCAGTAGCGGGTCATGCCCTCGCGCATGCCGAACACAAATACGTGGACTTGCGAGGCCATGTCGATTGGCTTGATCACGATGCATGACGC
CAGATGTCGCGTCTTCTGGACGTAATCACGCATGGACATCTGCCCTTGCCGCAGAGCGAAGAACTCTGCGCATACGCGAGACTCATCTTGCGGGGGCTCG
AACGCGAGGCGCAAGTCGCTCTGGAGAGTTTCCAGAGTCGGGAAAGCCTCGGGGTCGACAACCAGCTTCCCGAGGGCCCATTCTTTGGCCTTCCCGGTTA
ACCGGGAGAGGAGGAAGTTCATCTTGGCCGATGACGCCTCGATGCATCGCGAGGCGATAGCGATGTCGATCTCGCGGAACCACCGGTTAGCGGAAGCCGG
TTTTCACCGGCGCCAGAATACGTAGACGTCTTCATCTTGACGACGTCATTCTAGGATGGACGCGAGGGAGTTGACACCCGCCGATTCGCATCGGCGAGCT
CGCGTTCCATGAACTCTTGTGCTGCAAGACGTTGCTGGTCGGGCGTCGCTGAGCTCAGCAGCGATGCGACGACAGCGTCTCCGGACACCGCCACGAGGCG
GTGAAGCGCTTCCCACTCCACGCGAGTGAGATGGGGGAATGCAGCATGCTCCAGGGTCGCCCCGGAGATCTGGACTTGGCTCATCGTAGACTTGGTCGTT
GGAAGGACTACAAAGTGCTACCAGGTGTAACGGG