Description :
From Genome Similarity Track
Location :
Scaffold_11:389030- 393436
Sequence
4406 bases(100 bases per row)
GCTGGCACTGAAGAGCGCCCCTGCAACATTCAATCGATATGTTACACATCATATGCACCCAGTGCGCGACTTCGCACCAAGCTACTTCGACGATGTGTTC
GTTCACAGCCGGGATGTGGACCTAATTCCTGACGTTGAGGTGCGCAAAGAGCACCTTCGCCAACTGCTAGAGCTTGTGCGTAAACATAAGCTTTATGCGA
ACCTGAGGGAATGTATCTTCGGTGTGAGCTAGATACCCGTCCTTGGGTGTCTCGTTGGGAAAAATGGCGTACGCCTTTTACCCAGAAAAGGTCAGAGTAA
TCGATGAATGGCATACGCCATCCAACATGAAGGATCTGAGGCAGCTCCTTGGCCTCGTAGCGTACTTGTGCAAGTAAGATTCGCCCGCTGACACAGCTCC
TGAAAAGGGAGGTGGAGTGGATTTGGACTGCTAAGCATCAGCAGGCCTTCGATACAGTCAAGCAGGGCTTGACTGAGGCGCTGATCTTGGCCGTGGCTGA
CCAAGATCGCCCATTTCATATCGTGTGTGACACGTGCGTATTGATGCAGCACGATCACGAGGGCCGTAATCGTGTGATCTACTATCAGTCGCGCCAGCTG
AAGCCAGCTGAGCGTAACTGCCCTGTACGTGACAAGGAGCCCCTTGCCATGAAGTATGCACTCGCGAAGTTCCGAGTATATTTACTTAGGGGTAGACCGT
TTGTGGTCTACACCGACCACGCTTTACTGCGAACAGCAGTGAAGACTCCGCACATCTCCAAACGAATGGCGAGATGGTTGTCGTTCTTTGCGGAGTACGA
CTGCCAGGTTGGGTACAAACCTGGAAGGTTGAATGTGGTAGCCGACGCGTTATCGCGTCGACCTGATTATGCTGGAAAGACAGCCGACGCCAATTCGATT
GGCGACGACGGAACACTTACTCGTTCGACGCCACGAAAAGCGCGTATGCGAGTGACACAGATATGAAACGACGGCTAGCCTATGTCTTAGCACCTTTCAA
TGTATCACACCGGAAGTTGGCGTCACATCTGGGAGCTCGTGCACACCGATATCGTGTGCACGAAGGACTGCTGCTTTACAACGCAGTGGACGACGATGCG
ATCCGCATCGTGGTACGGAATAACTATGTTCTGCGTATGCGGACCATGCACGAGTATTACGATGCCCCTACGGCAGGGCATCCGGGCCGTGAGAAGAGAT
ACACTGTTCTCACGAGAAGCTTCTACTGGAGCCACCACTACAAGTGGGTGCATAAACGTACGTGCTTGCGAGGTGTGTCAACGCGTAAAGCCTGCAGCGT
ATTTGCAGGCTCCACTACAATCACTACCGACACCGTCGAAGTGTTGGCAGTTCATTTCAATGGATTTTGCTTTCGGTCTTCCGCCAGACAAAACGCGGAG
GCCTGGCGTTGTGGTCTTTGTTGATTGATTCAGCAAGATGGTTTATCTTGCTGCAGTACCGGCTGAAGTCACGACCGTGCAGACTACTTAACTGTTTGCT
GACATGGTGCTCCGACACCATGGAATGCCGCTTGACATTGTGTCGGACCGTGATCCACGCTTTACAGCGCGGTTCTGGCGAGAAGTGTTTACGCTTCTTG
GAACACAGCTGTTGATGTCGACTTCGGATCATCCGCAGACGGACAGACAGTTCAAGCGCGTAAATCGCATGCTCGGTGACGTACTGGAGATCTACGCACA
CTCGCTCCCACATTGGAATGGCTTGTCGATGGCATAGTTTGTCATCAACGGCTCCGTGCTTGTCTCGACAGAGCATAAACCGCTCTACATGAATGTCATG
CGGCATCCACGGCTTCCGAGCTTTCTTGAAACGGTGGTTCCCTCCTTAAGTGGCGGAGGAACTATGGCTGCGTCGAAACAACCGCAGAAGAAAAGTGACA
CCGACGTGGTATCGGTGGCGATGTGAACCCAAATAGCTCGTTCCGGGAGCGCGGCGAAGGCATATAACACCGTGTCTGTGCGGGGTACAGGCACCGCGAA
CAAGAAGACGTCTGTACCGGGTACAACTAGCGCGCAGACTGAGTCTACTGCAAAGAACAAACACGTATTTGCATGGCACAGACGGCGCGCAGGTTAGGCC
TGCTGCGAAGACGGAAGCCGCGCTGAACAAGTCATTCAGTACGCAATCACTGGACATTAACCAGAACGAAATAGCAGCTTCGGGTTACAGACGGAAGCTG
AACGCAGACAATATCAGTAGAGGAAAACACAAATGAATTCAACATGGGTTCATTAGTTCTGTTAGTTACACAGAACCTACCACGACATGCAGTCTCTGAC
ATCGGTGCAAGCAAGTTTGCTTCCCGCTTCATCGGCCCGTTCACAGTGCTTGTACGCCATGACGACGCTTATACGCTGGACATACCGTCTAGCATGCGCC
TTCATCCCCGACATTTTACGTCGGGCGAATCGGGCCTTAAGAGCGACGCAGGCCGACTAGTCTCGATGGCTCGATGGCGACAAAGCGGCGTGAGCCGGAT
TCTCAAGCGCGACGACGCGGTCGCGCAGGCGTCCCAGCTCCGATCCAAGTGCGACTTGGATGTTCGAATCAGTCTGAGCAGCCGCAGTGACATACGCCTT
CTGTAGGCGCAGCTCCCATAGCAGGGCAGTGAGCTCCGCGCTCTGGGGTCGTTCCTGGGTGACGCCACGATCGTGTAGAGCGCGAGAGCCATAGTAAACC
TGGGGTTGCCCATACTGAAGGTATCTTTCCGCCCCGCCGCCGCCGCGGCGTGACGCGCACGGATCGACACGTTGGATTGTCGAGCGGGTCGTGGACTATG
AAGCCCTGAAGGCGAACCGAGATCCGGCTCGCCTCCGTTTTCGCTGGAGAAGACTATCTTCCCATCGAGATACATGGGATCCACGGAACGTCCTGATGAA
GGACATTACGGAAATGGTGCGGGTGTATGAGGCCCAGCACCAAGTACAGGCATACTGTCTGCACTAAAACGGCGAGTATCATCAGCAGGGTGCATCACGG
TGCTCAAGTTGACCACGGAGGTCTGGCAGAGGAGCCGGTACACGTACGAAAGTGTACCCGAGAGCATCGTCTTCAGAAAGGAGCACGCAGTTTCAGGCAG
GCAATTCCCGCCTCCATAGCGTCATTATGGAGGCGATCGATGGGATGACGCTTCGAGAAGACCACGAAACGCTGGCGAGCCGCGACAATACGCTCGTGGT
AGCCTTTCGCATTGTTGTTGAAGCGCACAACAAATGACTTCCAAAATGACAAAGTGTCACACTGTGCTTTTGCGCGAAGTTTTCTTCGACGCATTCCATC
GGAACTTATGGAGGTGTCAGATGTAGTAGTCGCGCCTTTGATCCGCTAACGGATCAAAGTGCATGTCGACGGCCACAGCGTCATCATTGATGGCGCTGCA
CACGTACAATCAAAATGGGTTCGGCGGCGATGTCGCGCCGAACCTGTCATCGATCCCGGATGCAGTTGGCATCCAGAGAACGTGTATTGCAGGTGTAGTA
CGCGGGAAAAAGGCGGAAATATCACATGTGGCTACGCCACTTCTTCAGGACACGAACAATTCGAATCAGGAGCGTCCGGAACATCGTCCCGGCCACGCTG
CGACTCAACAGGGGGTCGGGCGTTGGTTCGGACGACTTAGAGTCGACAGAAGAAGGCGAGGTATTCAATGTCAGACCCGTAGTCAATGGATATGTCACCA
TCCTGATTAGCCCTTCATGACGACTGACGTCTTGTCAGTCGTCACTAATGCGCGCGTTTACTTAAGCATAGCGTGATATTGAGTTACACGTAGATTACCT
TCTGCCGCGGGCGTGCTCGCTTGCACGGACGCTGTTATTGTTTTTTGCAGGTTCAGCCACCGACGAAACAGACTCTGCCGGTGCAGACTCTTGTGCAGGC
GTCTTCCTCGGCGAGCTCATTGCGAAATGAGCTCGGATTTCTCAAACGTTTTGACAGCCTCGTCAATACTTTGGGGAGTGTTAAGACTAGAGAGTATTAG
CTTTACCGGGGGGGGGGCTACACGCAAATGGCTATACATATCCATTTGGCTACTAAAATGGTTTTACACGCTGGTGTGCGATACACCAATGGTTGTATTT
GGTAGACTGTTGCTCTGCATGCATTTAGGTCGGAAAGTCAATATCTTCAACCAATTAGAATAGTAGAACTTTGTCAACCATTCGTTGATAAATACTTTCA
TTTAGAATACTAGATTAGGAGGAAAGCCCAAACAACCAAATAAACAGATCGTATTTCTACCTGAAACCCGCTTCGATTCCCTATTTAAGTAATTGTATCC
TTAGGACGAAAGTATAGTTAATCTAAGTGAAACCCACCTTACGCTTCCGCATACATGTGCGCTAACGTGTAAGCCGAAGTAGTGGGCTTAAAGTAGGCCC
TTTACA