Description :
From Genome Similarity Track
Location :
contig_44:389030- 390370
Transcript NameFunction/comments
g8005.t1hypothetical protein

Sequence
1340 bases(100 bases per row)
TACACCAGTGTGCTGGTCGCTCTGCTCCAGCCGTTCCAGAGCGGTTGGTCGACGTCGCAGACCAACCTTACCCAGTACAACGACACGGACCAGTGTAATG
CTCGCCCCGTGGTGGAAGATACGTGCCTCATGTTCCCGGGACACACGAAATTAGAGTGGACGTTCGCCGTGAACGCGTGGATTTTCGGTGGTATGATCGG
CAGTCTGTTCTGCGGACACTTCAGCGATATGTGGGGCCGCAAGAAGCTGCTGTTTGTGAATTGTGCCTTCATCATTGTTGGCGCCATCGTCCAGGCGGCC
GTGTCCAACATTTGGGCGTTCGCCGCGGGCCGCGTCATCGCTGGTATCGCCTCGGGTGTCGCTACTGGCACGTTAGGATCATACATCAATGAGTTGTCGC
CGCCTCACCTCCGCAATATTCTGGGTCTGGGTCTGCAGATCTCCGTGACCATGGGTATCGTGCTGCCAGCATTGCCTTCTTCTTCGCTAACACCAGCAGT
GGCTGGCGGTACCTCGCGGGCTTCCCGGTCATTCTCGCTGGCATCTTCCTGCTGCTGGCCCCCAAGATGTGCGTTGAGAGTCCTGCCTGGCTGCTCATGA
AGAACCGCCGCGCGGAGGCGAAGGAGGTCATTGCTCGCCTGTACGGCGAGGAGAACATCCAAATCGCGCTCAACTGGCTCGAGCCTTCCAGCAAAGCGAA
CCAGTCCGAGCTGGGCGAGGTTAACACCGAGTCCCAAGTGAAGGAGTCGCTGTTCTCGCCTCGATACCGTATGCAGCTGGCCGCTGCTATTTTGCTGTCG
TGTGCCCAGCAGCTTTCCGGTATCAACGCCGTGTTCTACTACTCCAGTAGCATCTTCGCCGACGCTGGTATTTCGGACTCGCGTATCGGAACGCTGATCA
TCGACTTCATCAATATTTTCCCTGGTTTCGGGGCTGGCGCTCTGGCTGTCCGCTTCGGTAACCGCCAAATGATCCTCTGGGGCATTGCGAGCATGTGCAT
CATGGCTGTGTGCATGACCATCGCCTTCTTGGTGAATGTATCGGCACTCTCCATTGTCTTCACTGCTCTGTACGTCGTCGCGTTCGGCGCTACGATCGGT
CCGCTGGTGTGGGTCGTCACTGCCGATTTGTTCCCGGACTCCATTCGTGCCAGCGGCTCGTCCTTTTGCATCGGAATCAACTGGCTGTGCAACCTGATTG
TCGGTGTGGCATACCCTTACATTTCGGACGCTCTGGACGACTACGCGTATCTGCCGTTCGTGGTGCTTCTAGTCGTCTTCTACCTGCTGGCGCTGAAGCT
GGTGCCGGAGACCTCCGGTAAGAGCAGCGAGGAGATTCAG