Description :
From Genome Similarity Track
Location :
Scaffold_1:3890229- 3895761
Sequence
5532 bases(100 bases per row)
CTCGGCCGGTAGATACGGCTTCAGGCGCCCGACGTAAGGTGAAGACGCATTGCGGTCGGTTTGTCCAGCGTGTAAGCGTCTCCCAGCACTTTGAAAATTT
TGAATGGACCGATGTATCTTGGCGCCAGCTTGTTCGCGCCAAGGTTCGTAATTGCTGTCGATTGAATTCCGGTGGTCGACAGCAGGACTCGGTCACCTTT
GCGGAAGACGCTCATGATCTTCCGGCCTCGCTGGTCTGCGTACTCCTTCTGCTTGTCCACAGCAGACTGCAGCGCATCACGCACGAATCTCGAGATTCCT
TGGTGTTGCAGCATGAACTCCGATACCGCTGCGGAGTCGATCGGCGATGCAGCTTCGCGAGGAGCGAAGTTGGCTGCCGTCGGGCCGACAGGGGCGAAAG
CAGGCGATGTGTCGGTCGGCCTTCTTGCCTTCGAACACGTCCGTGATGCAATTCCACACACGGCAGCCGTTGACGTTACCGGTAATTCCGCGCCCACCGG
TTCTGCTACCAGTGGAACCGGCGCCACAGTGCTGTTGCTATTTCTCTCGCGGCTCGGCTTCACTCGACACTAGTGCCGGGCGGCTCGGCACTGCATCCAT
TCCTCCCCCACCAAGAGTGGAGGGAGCAGAGCCGGACGAAGACCCGAAGGCGAGCGTCGCTGGAACGCGCGGATGCCGCGCGTTGTTGATGAAGAACGGC
GTCACATCTGTCAACGCATGGGCTGCGGTTTTGATAGCGAACTGGGCGAGCGGCAGGAACGTACTCCACGACGGGAACGACGTGGCGTAGCTGCGAAGGA
CATCTTCAACGACTCGATTGACGCGCTCCGTTTGCCCATCCGTTTTAGGATGAGCTGTCGTCGATATCAACAAGCGCGTACCAAGCAGTTCGAACAATCG
ATCCCAGAAGGTCGATGTGAAGCGAGGGTCGCGGTCAGAGACGATGGATTCCGGGAGGCCATGATGCCGGAATACGAGGTCGAGGAACAGGGACGCAGTC
GCCTCAGCTGTCACTTGGGCTTCGACTGGAGGAAGACGGACCATTTTGCTAAAGCGATCGACGATGACAAGGGCGCCCGTGCGGCCCTAGTCGTCCGATG
GAAGGCCGAAGACGAAGTCCATGCTGACGGATCGCCACGCTGCCGTGGCGATACGCAACGGGCGCAGCGGAGCTTGCAATGATGGAGCTGGCTTGACGCG
CTGGCAAGTCTCGCAAGTCCGAACCCATTTGCGAATCCACTTGTACATCCGAGGCCAATAGAAGTCCCTCGAGATCGCCGCGAACACCTTCTCGCGGCCC
AAGTGGCCGCCCACTGGGGCGTCATGATATTCGTGGACGAGACGAGCACGAAGGTCGTCATCGGCGGGGATGACGACGCGCGGAGGATCGAAGGCGTCCA
TCGTGTATGTCAACAACGGACCATCGAGCTGGTATCGCTCGATGTGACTGCGCGTAGGGCGTGTCAGCTTCTTCGATGACTCTGCACTCGGAGTACGGAG
GTGCGCAATGATGTTGGCGTAGAACGGATCGTGTTCGTACGCATCAGGGATCTGCTGACGCAGTGGCAGGACTGGAGTCGTAATCGTCGCGTTGATACCC
AGAGCGATGCAACATGTGCAGCCTTCATCTTCGTCATCGTCGTCAGCAAGTTGCTGACCGACTAGTCGTCGTGGGTCGTAGTCTGGTCGGCGGGACAGCG
CGTCGGCAAGGATGTTGTTCTTGCCGGGCTTGTAGTGCACCACGAAATTGTATTCGAAGAAGAACGAGAGCCATCGCGCCATGCGCTGCGACAAGTGTGG
AGTCTTCATTGCGGTGTGCAGCGACGCGTGGTCCGTGTACACGGCAAACGTCTGCTCTCCGAGCAAGTACACCCGGGATTTGATCAAGGCGTAGCGCATA
GCGAGGAGCTCCTTGTCGAGGACGGGGTAATTCTTCTCGGCAGGCTTCATTTGTCGTGACTGGTAGCTCACGACGCGTTCGTGGCCCTCATCGTCGAACT
GCATCAGCGCGCAGCCGATTGCAAAATCACTCGCGTCGCACACGACATGGAACGGTTTCGTGTGATCCGGAAGCATCAAGACCGGCTCTTCCGCCAAGCT
CTTCTTCACGGAATCAAACGCAGCTTGGTGGTCGGGGGACCACAGTCACGTCGCGTCCTTTTTAGTAGCAAAGACAGCGGTTGGATCAGGCCGGCGTAAT
TCTTCGTGTACTTGTGGAGATAATTCACCAGACCCAGCCACTGACGCAGCTCCGTGGGGTTCTTGGGAGTCGGCCAAGAACCGATCGAGGTGACCTTCTC
CGGACCTACGCGAACGCCGTCCTTGCTCACGTAGCAACCGAGTACGGGAATCTCCGGCGCACAGAAGAGGCACTTCTTCAAATTCGCGTACGCTTGTTCT
CGCGCATCACTTGGAATACCTGCCTCAAGTGTTGAAGATGGACCTCGACAGCGCTGAGGTTGCCCTCAGCGCGGCTGTGCACGAAGATGTCGTCGAAGTA
GCTCGGCGCAAAGTCGCGGAGCGGGCACAGTGCGTGAGACACCATGCGGTTGAACGTGGCTGGGGCGTTCTTCAGACGCTGTGGTATCACGTGCCACTCC
CAAAGCATTCCGCTGGGGGTGCTTACTGCCGTGAGGGGTATGTCACTGGACCTCATCAAGATCTGGTAGAAGCCGTCTGTCAGGTCGATGGCGCTATAGA
TGACGCTAGCTGACATGGAGTCGAGTACCATGTCCTTCCGCGGGATCGGGGTCTGTGCCGGGATGGTCGCGTCATTCAGTTTATTGAACGCGTGGACGAT
GCGCCAGCCGCCAGTTGCCTTCTTCACACAGAACGTGGTGCTAGAGTGTGGGGAGGTGCTATCGCGGGCGTGGCCGGCCAGGCGGCGCTTTTCGAAGAAC
TCGTCGATGGCCTTGACCTGGTCTCGCGGCAGTGGCCACTGCCGCGTCACGCAGTACTTCGTTCCGGGCGCGAGATCGATCTCGTGCCGAACACCGCGGT
CGGCTGGAAGCTCGGCGGGGGTCTCATCAGGGAAGACGTCTTCAAACTCGCGCGTGGTGTCGTAGACTGGGTTACCCGACTCCTTCAGTACTTCCCAGGA
CTGCGCTGCGAAACGCTCTTCGCGGGCAGACTTCGGTTCGGCACTCCTCGGCCGCGACGACGCGTCGTCACCGCTGAGTGCATGAAGACCCTCGACTGTC
GCGTCGGCCTCGGTGATCAAGCACACCTGCTCGATGTCACCAGCCTTCAGATCGCGAAGGAAGTGTTTCCACGAGAGCCCGGGGAACTGAGTGATTCCGC
GAGCGTCGCGAGGGGGACTCGTGACTTCGATGACCCGCGTGCCCCGTGGAGCACCCTCCACGTATTCGACAGCCCAGTCAGATTCCGTCGGGGGAGGTGC
GGCTTCAGTGTTGTTCCGTGGCCTGAGGCGCCGTCGCTTCGATTTCCTCCTCTTCCTCCTCGAAGACGTCGAGGAGAAGCTCGAGGTGGACGACTCGCTG
GCACTGGACGATACTTCACCCCCGGAGTGTCGATCCCGCCCGCACCGGAAGTATGCGGGAGCACCACTTGCTTGACCGCCTCGTTGATGGGCGGGAACCC
CCGTCGCTCGACCGCCTCGTTGGTTCGCGGGATTCGCCTTTGCTTGACCGCCTCGCTGGGTCGCGGGAGCCCACTTCGCTCGACCGCCTCGTCGGTTCGC
GGGGGTCGCCTTCGCTCGACCGCCTCGTTGGTTCTCCGGAGTCGCCTTCGCTCGACCGCTTTGTTGGTTCGCGGGAGCACACTTCTCTCGACCGCCGTCA
CAACAACCTCGCTTCGCTGCGAGGTTCCGCGTTCATTTGTCGGTTCATCCAACAGCATCGCACATGCCATACAGAGAGGGTCATCGCTCGCTCTGTGTAG
GGCTTGCGTCGTGGATGAACGATCCACGACGGTGACGTGGTGCCAGTCAGTCGGAGCGACCAGGCGATGCGTGAGCACTTCGCTCACGTCGTAGTCGGCT
TGAGGCTTGACTGATCGGGCCAGCCAGTCAATCTCCGGTTGATACCGTGCCAGTCACGGTATGCACAAGATGCAGTCGAACGCGTAGTTCATCTCGATCA
CCAGGAACTCGTCGTTGCTACGGAAGCCGTCGAACGTGTACGGCATCATGATATCACGCCGTGGGACACGGTGTGGCTTGCCGTCAGCAAGCTTAATGAC
GACGACGCCAGGACCCTCGCGGACTGATATGTCCGAGGGGGGAAGCGACAAACACGAGGCGCGGAAGAAGTTGATCGTTGCGCCCGAATCCAGGAGCGCG
CGGAGAGGGCGCCGCGCGCCGGCGACGTGCAGGCTGACGATGATCAGTCTGTAGTCGCCGCTGGTGGTGGCATTGAAGTGTGCGTGAAGCACTGGGGGTC
TAGGAGATCGGGTTGCTACTGGGGGACCCGGACCTCCGTTCCAGCCAGTAGGGCGCCCGCACCTACTGGTCCCGGCCGTTTTTTGGTTGAGCGACCAGGA
TCTCGTCATCGGCGCGAGCGACTGCAGCAAGCATCGGCGCAGGCGCGCGGCATACTGCCGGGCGATGGCTCAACTTCCCACAACGGTGGCAGGTCAGCGA
ACGGGAATTGCGGCCGCCGCGCGAGTAGTACCGCCGGTTATTCTCCGCGGCTTCGACAGCATCGATTTCCATTGGCTCGGGCATCGCTGCCCGAGCGTCC
GCCGGCAACTGTTGCGAGTACGAAGCGGATACCGTGTAGTCCTCGCGCAATGCGAGGGCAAACGCTTCTTCCAGCGACTTCGGCTTGGCGCGCGTGATAC
AGTAGTGCCTCATTCCTTCTCGCATGCCAAACACGAAGACGTGGTCCTGCAAAGCCATGTCGATGGGGCTCGTGACGATGCACGAAGCCAGGTGACGAGT
CTTCTGTACGTAGTCGCGCATGGACAGCTTGCCCTACTTCAACGCGGAGAACTCCGCATGCATCCGCGATTCATCTTGCGGAGGCTCGAGCGCAAATCGA
AGGTCTTTCTGGAGACTGTCCAGACTCGGGAAGGCGTGTTGGCCCGCAACAAGCTTGCCGAGGGCCCACTCCTTCGCCTTCCCCGACAAACGCGACAGGA
GGAAGTTCACTTTAGCCGTCGGCGCCTCGATCAGTCTCGAGGCGATTGCGATGTCGATCTCCCTGAACCAGCGGTTCAGGGGCAGTCGGTCTTGGCCGGC
GCCGGAATACGTCGACGCCTCCATCTTCACCGCATCGTTCCGGGAGGAATGCGAGGGAGTTGACACTTGCCGCTTGGCATCGGCGAGCTCGCGTTCCATG
AACTCTTGGGCAGCCTGGCGTTGTTGGTCGGCGGTCGCTGAGCTCAGCAGCGAAGTGACGACGAACTCGCCGGACACGGCAGCGAGGCGGTGAAGGGCTT
CCCACTCAACCCGGGTGAGGTGGGGGAAACTCGTGTGGTCAAGGGTTACACCGGACCCTTCGGAGATCAGGACTTGGCTCATCTTGGTCTTGGACGTTGG
AAGGACTACCAAGTACTACCAGGTGCTACGGG