Description :
From Genome Similarity Track
Location :
Scaffold_17:389021- 396922
Sequence
7901 bases(100 bases per row)
CTACATCGTCTTCATCCAGCGAAGCTTGTCAACCCAATGCACCGCGTGGGTCGTAGTCGGGACGCCGAGACAAAGCGTTGACGAGAATGTTGTTCTTGCC
GGGCTTGTAATGGACCACAAAGTTGTACTCAGAGAAGAATGAAAGCCAGCAAGCCATCCGCTGGGATAGATGGGGACTCTTCATCGCGGTCCTCATCGAT
GCGTGGTCGGTGTACACCGCGAAGGTATCCTCACCCAACAAGTACACTCTGAACTTGATCAGAGCGCATCGCAAGGGGCTCCTTGTCGTGAACAGGGAAT
TGCGCTCTGCCGGCTTCATCTGTCAGGACTGGTAGCTCACGACACGCTCTCGATCTCCATCGTCGAATTGCATCAGCGCACAGCCGATGGCGAAATCGCT
TGCGTTGCAGACGACGTGAAAAGCCTTCAAGTCATCAGGGAGCGCGAGGATTGGGGCCTCGGCGAGACGCTTATTCACCGAGTCGAAGGCGGCTTGATGT
GCGGGAGTCCATGACCACGACACATCTTTCTTCAATAACGAAGAAAGCAGATGGATCAATCCGGTGTAATTCTTCGTGTACTCGTGGAGATAATTTGCGA
GACCGAGCCGACGCTGACGCAATTCAGTGGGATTCTGTGGCGTAGGCCACGCACATATCGATGACACTTTTTCGGGGTCGGCGCGGACGGCGTTCTTGCT
CACAAAGCTGCCAAACACCGGAATCTTCGGCGCGCAGAATATGCACTTCTTCAAGTTGGCATACAGGTTGTTTTCGTGCATCACGTGGAAGACTTGCCTC
AGATGCTTCAAGTGGACTTCAAGCGCACTGAGGCCTGCCTCCGCGACTGTGTACGAAGATGGCGTCGAAGTATCTCGGTGCGAAATCGCGGAGCGGGCGC
AGCACATGGGATACCATGCGATTGAACGTGGCGGGAGAATTCTTCAGGCCTTGTGGTATAACAAACCACTCCCAGAGCATACCACTGTGAGTGCTTACTG
CCGTGAGCGGTATGTCGCTCAGCTCATAAGGATTTAAAAGAACCCATCGGTCAAGTCGATGGCGCTGAAAACCTCACTACCCGACATTGCGTTGAGAACC
ATGTCCTTCCGAGGAATCGGCGTCTGGGCAGGGACGGTAGCGTCGTTCAGCTTGTTGAAGGCATGGACGATGCGCCACTTTCTTCGCACTGAAGGTCGGA
CTGGAGTGCGGCGATGTGCTCTCACGCACTTGACCCGCCTTGCGGCGGCTCTCGAAGAAGTCATTGATAACTTGGATCTGATCTCGCGGGAGCGGCCACT
GCCGCATCACACAATACTTCGAGCCGGGCACGAGATCGATCTCGTGGCGAATTCCTCGGTCAGCTGGTAGCTCAGCCGGGATCTTATCCGGAAAGACATC
TTCATTTTCGCGGGCGGACTCGTAGACCGGATTGCCGGATTCGCGTAGTGCTTCCCAAGATTGCGCTGCGAAGCGCTCCTCGCGCGCCGAATTCGGTTCG
GCGCTCTTTGGGCGCGAGGGGGCGTCGTCGTCACTGACTGCATTCACTTCGAGCGACGCCGAATCGGCGTCGGTGATCAGGCAAACCTGTTCGATTTCAT
CGTCCTTGAGGCCGCGAAGAAAGTTCTTCCAGGAGAGACCTGGAAGTCGAGTGATCGACCCCGCGTCTCGAGGTGGGTTTGCAAGCTCGAGTGTTCGGCG
GCGACCGGAGGTACCTTCCGCATACTCAAGCACGCAGACCGGAGAGCTGTCATTTGGTACGGGCTCTCGGTGAGGTTTCAGCCGACGCCGCTTAGACTTT
CTCTTTTGCCGCCTCGAGTGCGAACTCGAGGATGATGAGTCGCTCTCGCTGGACGAGAGGTCACCCCCCTCTAGCGGGAGCCCCTGCTCGCCCGCGGTAG
TGTTCAGCGGGAGCGCCAACAGCTCGACCACCGGCTCAATTGACGGGAGCCCCTGCTCGACCGCCATCTCGTTCGTCTGCGGGGTCCCCTGCTCGACCGC
CAGTTGATCTTCATCCCCGCGTCGCCGCGGGGATTCGTCAGTTAGCAGCACCGCGCAAGCCGTGCTGATAGGGCCATCGCTCACTCTGTGCACAACGTGC
GTCGTGGATGACCGGTCCACGACGGTGACGTGAGGCCAATCCTTCTGGACGACCAGGAGGTGCGTGAACACCTCGCTCACATCATAATCACTGCGACGCT
TGCCCGATCGGGCCAACCAGTCAATCCCTGGCTGATAGCGCGTCAGCCACGGCATACCCAAGATGCAGTCAAACGCGTAATTCATCTCAATGACGAGGAA
GTCGTCGTTGCTTCGGAAACCGTCAACGTGTATGAGAAGTTTAATCTCGCGCCGCGCGACGCGGCGTGATTTCCCATCGGCCAACTTGACAGCGACCCCC
CCCCTACCTTTGCGGACAGGGATGTCCGACGGGAGTACCGGCAAGCGCGACGCGCGGAAGAAGTTGTTGGTTGCTTCTGAATCAAGGAAGAAGTTGTTGG
TTGCTTCTGAATCAAGGAGCGCTCACAGTGGTCGCCGGGCACCGGCGACATGAAGACTGACAATGATCAACCTTGATTCGCTCGGCTTGGTGGTGACATG
AAAGTGTGCATGTAGCACAGGAGGACTAGGAGGTCGGGCTGCCACCGGGGGACCCGCACCTCCATTCCAGCCAGTAGGGCGCCCCGCACCTACTGACCCT
GACCGTTTTTTGGCTGGTCGGAACTCACGGGCTCGGCATCGACATGCACGAGCACTGGGGCTGGCGCGCGGCACTCCGCCGCGCGATGACCGACCTTCCG
GCAACGGAAGCAGGTGAGAGAACGACTGTTCCGAGCACCGTTTCGACGCGCTACATGACGCTGGCGATTACTCGTCGCATCGATAGCGTCGATGGCCATG
GGCTCGGGTGCAGATTCCCGAGCTGAAGCAGGTAGCGCGTGAGCGTATGACGCCGCAACCACGTAGTCCTCGCGTAGGTCGAGGGCAAATGTCTCTTCGA
GTGTAGAGGGGTCCGATCTTGTAAAGCAGTAGCGCGTCATGCCTTCGCGCATACCGAACTAAACCTATGAGGCCATATCGATGGGCTTGGACACGATACA
CGACGCGAAGTGTCGTGGCTTCTGGACGTTGTCGCGCATAGTCATCGTGCCTTGCCGAAGGGCGAAGACGTCTGCCCGAATTCAGGATTCATCTTGCGGC
AGCTCGAACGCGAGCCGAATGTCACTCTGGAGAGTATCCACAGTGGCGAAGGCTTTGGGATCGACGACCAACTTGCCGAGAGCCCATTTCTTGGCTTTCC
CAGACAGCCGCGAGAGGAGGAAGTAGACCCTCGTGGAAGGCGCCTCGATCAACCTTGAGGCGATGGCGATGTCGATCTCTCGAAACCAGCGATTCAGCGG
GAGTCGGTCTTCTCCGGCATCGGCACCGGAGTAGGTGGACGTCTCTAGCTTCACGACGTCATTCGTGGAGATACGCGAGGGAGTTGACACTCGCCGATTC
GCATCGGCGAGCTCGCGTTTCATGAATTCTTGTGCCGCAATGCGCTGCTCATCGGGCGTCGCTGAGCGCAGCAGCGACGACTTATCCGGACACCTCCGCG
AGGCGGTGGAGAGATTCCCACTCGATCCGAGTGAGATGGGGGAAATCAGCGTGGTCGAGGGCTTGACTTATGTCGACTTTGGTCATTGGAAGTACTACAA
AGTGCTATCAGGTGTAACGGGCCAGGTATTTACTCCGTTACTTGCTTACACTATATCGTTGAGGAAGCTCGCAATAGGAAGACTGAGTCTTATGCTTAAG
GAAAAATCAACTCTGAGTTTATTTTAGGACCAAGGCCACAGCCCTGGCCACTCAAATGCACGTCATAGTTCAATTGGCTAATAATGGGTCTGGCTCCCCA
TATATCAGCCAATGGCATGGCAGCATTTTCAGCACACGCTAGTCGTGTGCCGATGCACCTACTTATGTAAAGGAATCTACCTATTTCTGTAATGGAGGGG
CCCATTACACAAGCAGTGAACCGCACTACACGATGTGTGCGAAGGCCGTCCCCGCGTTTCTGCTGTTTGATTCCATGGGTATATTTCAGCGTCTTGCAGT
AAACCACCCAGGAAGAAGGGATCAAATATCTCGGCGATACTTCGTTTAGATCCGTAGCCTTGTCGTCTTCATGCCCGGCTGAACCTTTTTGCGTGGCTTT
GCCGAAATTGTCTCTTGCCTAAAATCTGTTTGTTTCGTATTTCAACTCAAGTTGTCGATCAAACGGGGAAGCGTTGATACGTATTTGCACTGAACAAATC
GAATCGCTCGTGAAAAATGTCCCAAGATCTCCATCGAGCTGAAAATACAGTAAAGAAAGTGCCGTCACTGTCCGGAATTATTGTATTCATGCCGAGGAGT
CGATCCAGATATACATCCTCCGTTTCCGGTGTCAAACGCTGTACATCCTCCGGTTCAAAGTGTTGTTCTGCGCGCCTAGCCCATTCCGGTATATACCTCG
GTAGCTCGTCCGATGTATATTTCTGTCGAAGGTTGACCTCCGATTTCTACTGTATCGGTGGTGGAGACTTCTGTACCCTACGCAACGCCGTTGTACTCGA
CCTTGTTTACGGAGGCTCTGAGTCTTCGATCCACCACGCGAATTCTGTAGCGGTTCTGGAGTAGATCCAAGAGGACATATGCCATGTAGATTCTTTCCAA
CTGGAGACTTGTCTTCACCGAATAACACCCGCATTATTGAACTACGCGTTTTTACTTTTTTTGCTGTCCTTTGAACGCCGTATTCGTCCTCAGACGGAAA
ATCATCATCTCCGCTATCGTCCAGGTCAGCCGCGTCATCACCAAACGCCATCGTAGCTTCCCTCAGGATCTCATGTAGCTAACGTGCATCCAATTTCTTG
CGTTTCTTTGCCGTAGAGACGGCCTTCTTCTTACCAGAGCGTTTCAACAAGTCCGCCTCTTTCCCGACTTCAGGAGTCTTGTCTACCGCAGAGCTCTATC
TTCGCGCCTTCATTAGTGATGCGCCTCCAGCGTTTTTGTTTTGAAAAACAGCTTCTCCAGACTTTCATAAAGCAGTTGGCTGTGCCTTTGCATAATCTTC
GCGTACTCGTCTCGTCGCGCTTCTTTCGTTCTCTCGATGTTCTCCCTGAAACGCTTGAGCTGCTGTAAGCGACTTTGTACTGACGCTAGCGTCCTTGATC
GCGAATTGCTCCGTACTCGTCCAGCGCTCACGCACGAGCGAATTGCTATCTTCGTCACTGGATTCAGAATCCAACACAGATATGAGGAAATGCTGTTTTC
ACGGTGCAAGCGGGGGGGGGGGCAAAGGCTGCTTACCATTCGCGCGCAGGCTTTGATCTGTACTCGGACGGCGGTACGATGGTCAATCCTGAAAATTGAC
GGCTGTGGACGGCTATGGTAGCGCGACGCGATCTGAAGAATGACACGCGTCCATGGCAGACCACACAAAAAAGATCAGCAAAACAGAATTATAACAGAAA
AAATTATAAAAATATCTTATCAATATTTCTGTGACGTGTGCTAGAGCTACATCATTTACAACCTGGTTCCGGTACATGCGGTTGAGGATGGGCCAAAAAA
CTTGTCATTGGTATTTTTTAAAATTTCGGCAATTAAACCAAATCAAATACTTTTTAAGTTTTTTTATTGGCTCAAATGGTTCTTTTGACGTGCACTTGCC
GTTGCAACATGGTCGCGCCATGGTGCTTGCCGCGAGTAACTGAATGGGTGGTTATCGTGGTACTTGGACACGTGTGGAAGGCAAAGTTTTCTAGCTACAC
GAATCCAAGTTTCTTAAGCTCGGGGAGGGAGGTCTCTGTTCGCAGTGCAGATCTGCAATCCAGCTCAAAAGAGTCAATCGATTATCAAAGGTAAGCACTC
AACGATTTTCTCTCTTTCTGCGCAAGCGAGTCAGAGACTTCGGAAGAACCGCAGCTACTCAAGCTGTTTCATCCTACGAACATATGGCAGCAAGGGTGCG
CCAAGCTCCCAGTGTTGGCAGATCTTCTGGTCAAAGTAAACTCGTCTCCTGCTTCTACTGCTGGTGTTAAACGTCAGCACAAAGTTGGAAAGCGGATCCA
CTGTGTTTCCAGGAGCTGAATCGGCACTGGGATGGTAGAAGAGCAGGTCGCTTTTGCGCATAACGCTGTCGTCGCAAAGATGTAGATATCGTCCGAAAGA
TAGTCTTTGAGCAACGAATAGTCTCCGAAATACTCGAAAAAGGAGAGCATTTGGAATATGTTATTCGAGATGAGGCGCCAACAGTCGAGGACACAGGAGT
TGCCGACGATAACTTTCTGTTTACGGAGGCCGCGGAGTAGCAAATACTACTGTAGTACTGTATAAGCTACACGTAAGTAAATAGGGAACGTAGGATAATA
GTAGTAGTAGTAGTAGAAGTAAGAAATAGTAGTAGAGCAGCTCTACCAAATTGCATGTGATACCTGTGTCGATTAATATTAAAACCAAGACAGGCAAAAG
CAAAAGAATAAACCCGTTTTTAATCCAGGGTTTTCTTTTAATTTAAAAACCAACCCATCCATAGTGTAACTGTTACAAGAGGCTGCGTCAAGGACTTAAT
TTTTTATATGAATGGAAAAGCAAAGGTGCTCAAAAATAATCCATCGTCATCTTAGATAACGACTTCATACAAAATGTCCTATCTGTTAGTGATAAATAAA
TTAGGTTGTTCAGCTCTAATTATATTGATTAGCAAGCTGCAAGTTAGAGAAGTTGATCTATAGTAGAAACATCCCAAAAACGGGAGTTTTCTCGCAGGAA
AAAAATAATTTCCAGCGTAATGGACTGCAAGCCATTACGCTCTTGCCCAAGTGTTGTGCGAGCAACACTAAAAAACCGCTCCACCTTGTTCGAGTAGCCG
GAATGCTGCTAACGAGGCTGCATCGGACTACTCTTGGATCAAGCCGGCGACGCTTTTTAAGCCGCTGTACAAAATGCTCATAATCGGTTTCTTCTTCATA
ATTGTATGGGTTGATTGTTAGGGTCCGCAAGAAGGAAAGGACGAAGAGCCCGCTTCTCTGCTGTGGTGAGGCGGGCTTCACATCCTTTAAGAACCCGGAC
ACAGCCCGACTCAAAGTCTGGGCTGTCAACGATGTTTGCCCGAGGACCTATGTGTATCACTTTAAGCTAGCAAATATTATAAAGCACTAGAAACAAAGCA
AACCGTACCGACATAAGTAGCAAGCGCAGGCTGTACTTCAATAAGTCCGTCGAGCCGTGCACGCGCGTCCAGTAAGCTCACGTTCTCTCCTTGTAAGGCT
TTTGGCACTAACTCAAAGTCCTTGAGGTCTGCGTAGAGCTTCTTGAGTCGGCGATTGCACGCCGGAGACGGAAGCAAGTCCAGGGGCTCTGCATCTTCTC
GGTCAAAAACTCCAACAGGGAAAAACAGCGATGCACTATTGCGAAGGTGGATCCCAGCGGGTATCCTGACGAATGACTGGCCGAAGTAGAGTCTTGAATC
TAATAAAAACAAATTACCATATTAGTCGCGTATTAGTAATACAAAACGATACTAGTACTAAAGTAGAAATCAATAGTAAAATCAAAAGTACTTACCGAAG
TTTCGTTGACTGCTTAAGCGTCCGCAGCTTTGACATCAGAGCTTGCACAGCAGCCAAATCTTCGTCGTGCTTTGCCAAGTGATGTGGAGCCGCCCAATTT
ACTAGCACATCCGACCAATGACACTTGCACTATGGTTGCGAGTCGCCTTTTCACAGAACAGTTGTCCCCGACCAGGTGCTTGCAGCAGCTTAGATTTTTC
CCACAATCTCTTTCGAGCGTTTCCTCTAGAAAAGCGCGATGGATGCGGGCTGACAAGTCCTCGTCCGGCTCGTTGATGACCGGGGCTATGCTAAGGGGCT
G