Description :
From Genome Similarity Track
Location :
Scaffold_130:389- 4224
Transcript NameFunction/comments
Phyke_g4593hypothetical protein PHYSODRAFT_351206
Phyke_g4594arginine N-methyltransferase

Sequence
3835 bases(100 bases per row)
TGATCAGATCAAGCAACAGATTTATGTCGAATTTTGCTCGGCTCCTTCGCGGTGAAATACTGGTAGATTCTCGGCCCAATAAGGCACTCAAAGTACCGTC
AGACTTGCCGCGCTGGACAACATATCTATACTGTCGTACGTTGGGAGTCCTCTGTGCGTGAAGGTGTTCGACGAACATGGTCGAGTCCATTCAGATCGCA
AGTCGTACTTCCGAAAACCATGGCTTGGCTTGACGTGCGTTTATCATATTCGTAAATAACATACAGAAATACCAAGATGTCGATCGTTATCTGATGTTGG
ACAATGAGAAGACAGAAATCCTGACAGGGGCCACGTACAGCCCTTTTGGTGCAGACCTGAAAGGAGGAGCTGATCTATTCGTGGACGCCGTTTTATTCAT
GACTTATCATTCCTATCAGGCATCTCCGCCAACGACCAGACGGTAGTGACGGCCAAGGTTTCAATGTGCTACGACAGTGTTAAAGTGATCACACATCGTG
TGCTCGACTGTAATAATCCAGCCAAATCGATGGCAAGGGACGTAAATACTTCCCGCCACATATCCATCAACACTGATCACGTCGGCAGATTTGCGAGAAC
TATCCCTGAGCTGGTCTACAGATCCCGCTACAGGAAGCGGCAAGTGCGTTAAAGGAAAGGGGCGCATCCCTACAAAGCAACCCCACGGCCTGGAATAAGT
CCAGTCGACTGACACCTGACCTCGAAGGCTTCGATCAAAGTCAGCAATCCTACTTCGGCGCTGCATGAAGACTCTCGCGTAGCCGCGACCCAATAGACCC
CAAATATGACTAAGACAGTCCCCGCGCGTCTCGCGCGAGCCACCGGAAGAACAGAGCTAgccccaccgacgggtacacaaggtgagcCAATAATTCAGCA
TCCCCACAAATATCAGAGTATCCCCCCCGTTAGTCGGAAGTCTCGGCGCTGTATGAAAGTTGCTTGGATCGCATCAGGGATATTGTTGATCCCACTTCGC
CACAATAATTGCAAACACAAGACCTGAATTAAATCTGCAAGCCTGTTGATTGGCGATGCTCTAAGAAGTGAAAGTTCTAGCGATGTAGGAATCACCACAG
GTGTATGAAGCTAAAGTTGTTGTAAGTGAGAGCTAGACTTGGAGATAATTTTTTACAAGGGTTTTCATACCTCTAAATAAGAATCAATGCTTAGTGGTAT
GAAAATCCTTATAAAGTTTTAAAATACTAAATTTAGTAATAACTAATTTGGTCACATCAACAGTGTATCAACCCGCGCAATTTAGCAAGTCATATCAATT
TGACTACTATGTAGTCAAACTCACGTAATGACTTCCTGGAAACTTTAGTATTTGGTTAAAGCTTTCTTCGCGGAATTGTCTCGTGTCTCGTCAGCACTCA
CTTCTTGGCCTCGATGgtgcacagcagcaagtacgaTCTGCTCATCAAGCTCCTGCTGATCGGAGACAGCGGTATGTCTGCTTactccatcgccttctcT
GTCCAAAGCTCCGTTTCTAACGCTCTCTGTCTGCTTCTCTGCCATTTCCCAGGCGTGGGGAAGAGCTGCGTGCTCCTCCGCTACTCAGACGACTCCTTCA
CGACttccttcatcaccaccatcggGTGCGTCCTGTAGACTCAGTTGACTGTTGTCTACCTTAAACTGTGTCAATGTATGGCGATCTAATTGTGTGAATA
CATCTACTCTAGTATCGACTTTAAAGTAAAGACCATCGATGTGGACGGCAAGCGGATAAAGCTCCAGATCTGGGACACTGCAGGCCAGGAGCGCTTCCGA
ACGATCACGACTGGTGCGATTTTGGTTGGATTTTGTTGGTTGGGGAGTGAGATTTATGAACTGATTGTATGAAATTGTGTTGTTTATTTAaaattgttgt
tgttggtagCTTATTACCGTGGCGCGATGGGGATTCTGCTGGTGTACGATGTGACGGATGATCACTCCTTCCAGAGTACGTTGGGGCTGCATCCTCATGT
ATTACAATGCAGTTGTGGCTGGATATCTGACATCTTACGTCTTGGTTTTGCTGTGTAGACATCCGCAATTGGATGACACAAATTCGACAGAACGCGTCAT
CAAATGTAAACAAGATCCTGATTGGGAACAAGTGCGATGTGGACCCGTCAGAACGAGTATGTCAAGGGTTTCATTTTGAATTGTGATGGTGATGCGGTGC
TGTTTTACTGACAGTTTGTTGTCGCTTGATCCTTCCTAGGCGGTGACAACGAAGCAGGGACAGGATCTGGCCGACGAGTTTGGCATCAAATTCTTCGAGA
CAAGCGCAAAGAGCAACACGAACATCGACGAGGCCTTCCGCTCCATCGCAGTGGACATCCAGAAGCGGCTGGCGGAGAGCGAGCACGATAGATTAGATGT
GGCGAACGGCAGCAAATTCCGCGTGGACGAGTCGCAGGAGCAATCGAAAGACGGTTGCTGCGCCTAGTTGAATGCCTCTGCACTTCTCCCGCTGTTGCTT
CCCATGTTGTTAAGGACACACACAGCTCAGTTATAAGGCACCAGATAACGATTAGCTTTCATACACACTTGCACACCGCCTCAAAATTcaaagtgtagcc
atctgaTATGAAGTTTGACTACCAGATAGTCAAGCGTTAGCCATCGTGCCAGCCATTGACACACTTTAGCTGAGACTTGACCAGTGACAATGGCGCACCG
TGAGGACATCGTGGGCGTGGACGGCGGCGAGACATGGGACGACTGGGTGGATGACGGCTCCTCCACCAGCTTTGACTGCGTGTTTTGTGCCAGCAAATTC
CCGACCGAGACGCCTCTGCACGCGCATCTGCAAGAGCTCCACGACTTCTCACTGCACCAGGAAATCGCGACTCGCAAGCTGGACACGTACGCCACCATCC
AATTGGTCAATTACCTGCGTCAGATGACGCTGGATGGTGTTGCAAGTGAGactgtgaagaagacacTGGCGACGGAAGGCACCACTGCGTTCCAGAAGGA
CCAATTCCTCAAGCCTGTGGTGGCGGACGACCCGCTGCTCTACTGTCTTGACTGTGATAGCGAcagcgatgaggacgacgaggccAATACtgaggaagag
cagaagaCGGAGAAAGTGGTGGATAATGCCAGTGATTTGATCGCCAAGCTGCAATTGGAGAACcaggagctcaagcagcagatgacCAAGTACTCCAAAC
TCGTCCGCGACTTTGTGGTCGACGGTGAGAGCGCAGCTCCTGTTGAGGATGCTGCAGATAACGACACGTACTACTTTGACTCGTACTCACATGTGGGTAT
CCACCGCGAGATGATCACGGATGGAATCCGCACCGATGGCTACCGCAACGCGATCCTCAACAACCCGGAATTGTTCAAGGGcaaagtggtgctggatgtg
gGCTGTGGTACAGGCATTCTAAGTATGTTCGCAGCACAGGCTGGGGCTGCTAAAGTGATTGGTATCGACCGCAGTGAGATGGGAGATGTGGCTCGTGAGA
TTGTTGAAGCTAATGGATTTAGTGATGTGATCACTATTCTTCGCGGTaaggtggaggagattgaTCTGCAGGTGGACAAGGTAGACATTATCGTCTCCGA
GTGGATGGGTTACTGTCTTCTGTATGAATCCATGCTGGACACGGTGTTGTTTGCACGTGACAAGTGGCTTGCGCCCGGCGGCCACCTGTTCCCGGACAAA
TGCTCCATGTTCATCCAAGGTATGCAAGACTCAACCCAGCGCTTTACCTTCTGGGATAACGTGTACGGCTTCAACATGCAACCTATCAAGTCCAAGATCT
CCATCCGTGACGCCTTTGTGGAGGATGTTCTGCCG