Description :
From Genome Similarity Track
Location :
Scaffold_17:388903- 396922
Sequence
8019 bases(100 bases per row)
AGGATACAGGAGTACATCGCGTCATGCTCGTAAGCAGCTCGGATCTTGTCGCAAAGTGGCATTACCGGGGAGACGCTCCGGAGGTTGACTTCTGACGCCT
CGCACGTGGCACACTCGTCTACATCGTCTTCATCCAGCGAAGCTTGTCAACCCAATGCACCGCGTGGGTCGTAGTCGGGACGCCGAGACAAAGCGTTGAC
GAGAATGTTGTTCTTGCCGGGCTTGTAATGGACCACAAAGTTGTACTCAGAGAAGAATGAAAGCCAGCAAGCCATCCGCTGGGATAGATGGGGACTCTTC
ATCGCGGTCCTCATCGATGCGTGGTCGGTGTACACCGCGAAGGTATCCTCACCCAACAAGTACACTCTGAACTTGATCAGAGCGCATCGCAAGGGGCTCC
TTGTCGTGAACAGGGAATTGCGCTCTGCCGGCTTCATCTGTCAGGACTGGTAGCTCACGACACGCTCTCGATCTCCATCGTCGAATTGCATCAGCGCACA
GCCGATGGCGAAATCGCTTGCGTTGCAGACGACGTGAAAAGCCTTCAAGTCATCAGGGAGCGCGAGGATTGGGGCCTCGGCGAGACGCTTATTCACCGAG
TCGAAGGCGGCTTGATGTGCGGGAGTCCATGACCACGACACATCTTTCTTCAATAACGAAGAAAGCAGATGGATCAATCCGGTGTAATTCTTCGTGTACT
CGTGGAGATAATTTGCGAGACCGAGCCGACGCTGACGCAATTCAGTGGGATTCTGTGGCGTAGGCCACGCACATATCGATGACACTTTTTCGGGGTCGGC
GCGGACGGCGTTCTTGCTCACAAAGCTGCCAAACACCGGAATCTTCGGCGCGCAGAATATGCACTTCTTCAAGTTGGCATACAGGTTGTTTTCGTGCATC
ACGTGGAAGACTTGCCTCAGATGCTTCAAGTGGACTTCAAGCGCACTGAGGCCTGCCTCCGCGACTGTGTACGAAGATGGCGTCGAAGTATCTCGGTGCG
AAATCGCGGAGCGGGCGCAGCACATGGGATACCATGCGATTGAACGTGGCGGGAGAATTCTTCAGGCCTTGTGGTATAACAAACCACTCCCAGAGCATAC
CACTGTGAGTGCTTACTGCCGTGAGCGGTATGTCGCTCAGCTCATAAGGATTTAAAAGAACCCATCGGTCAAGTCGATGGCGCTGAAAACCTCACTACCC
GACATTGCGTTGAGAACCATGTCCTTCCGAGGAATCGGCGTCTGGGCAGGGACGGTAGCGTCGTTCAGCTTGTTGAAGGCATGGACGATGCGCCACTTTC
TTCGCACTGAAGGTCGGACTGGAGTGCGGCGATGTGCTCTCACGCACTTGACCCGCCTTGCGGCGGCTCTCGAAGAAGTCATTGATAACTTGGATCTGAT
CTCGCGGGAGCGGCCACTGCCGCATCACACAATACTTCGAGCCGGGCACGAGATCGATCTCGTGGCGAATTCCTCGGTCAGCTGGTAGCTCAGCCGGGAT
CTTATCCGGAAAGACATCTTCATTTTCGCGGGCGGACTCGTAGACCGGATTGCCGGATTCGCGTAGTGCTTCCCAAGATTGCGCTGCGAAGCGCTCCTCG
CGCGCCGAATTCGGTTCGGCGCTCTTTGGGCGCGAGGGGGCGTCGTCGTCACTGACTGCATTCACTTCGAGCGACGCCGAATCGGCGTCGGTGATCAGGC
AAACCTGTTCGATTTCATCGTCCTTGAGGCCGCGAAGAAAGTTCTTCCAGGAGAGACCTGGAAGTCGAGTGATCGACCCCGCGTCTCGAGGTGGGTTTGC
AAGCTCGAGTGTTCGGCGGCGACCGGAGGTACCTTCCGCATACTCAAGCACGCAGACCGGAGAGCTGTCATTTGGTACGGGCTCTCGGTGAGGTTTCAGC
CGACGCCGCTTAGACTTTCTCTTTTGCCGCCTCGAGTGCGAACTCGAGGATGATGAGTCGCTCTCGCTGGACGAGAGGTCACCCCCCTCTAGCGGGAGCC
CCTGCTCGCCCGCGGTAGTGTTCAGCGGGAGCGCCAACAGCTCGACCACCGGCTCAATTGACGGGAGCCCCTGCTCGACCGCCATCTCGTTCGTCTGCGG
GGTCCCCTGCTCGACCGCCAGTTGATCTTCATCCCCGCGTCGCCGCGGGGATTCGTCAGTTAGCAGCACCGCGCAAGCCGTGCTGATAGGGCCATCGCTC
ACTCTGTGCACAACGTGCGTCGTGGATGACCGGTCCACGACGGTGACGTGAGGCCAATCCTTCTGGACGACCAGGAGGTGCGTGAACACCTCGCTCACAT
CATAATCACTGCGACGCTTGCCCGATCGGGCCAACCAGTCAATCCCTGGCTGATAGCGCGTCAGCCACGGCATACCCAAGATGCAGTCAAACGCGTAATT
CATCTCAATGACGAGGAAGTCGTCGTTGCTTCGGAAACCGTCAACGTGTATGAGAAGTTTAATCTCGCGCCGCGCGACGCGGCGTGATTTCCCATCGGCC
AACTTGACAGCGACCCCCCCCCTACCTTTGCGGACAGGGATGTCCGACGGGAGTACCGGCAAGCGCGACGCGCGGAAGAAGTTGTTGGTTGCTTCTGAAT
CAAGGAAGAAGTTGTTGGTTGCTTCTGAATCAAGGAGCGCTCACAGTGGTCGCCGGGCACCGGCGACATGAAGACTGACAATGATCAACCTTGATTCGCT
CGGCTTGGTGGTGACATGAAAGTGTGCATGTAGCACAGGAGGACTAGGAGGTCGGGCTGCCACCGGGGGACCCGCACCTCCATTCCAGCCAGTAGGGCGC
CCCGCACCTACTGACCCTGACCGTTTTTTGGCTGGTCGGAACTCACGGGCTCGGCATCGACATGCACGAGCACTGGGGCTGGCGCGCGGCACTCCGCCGC
GCGATGACCGACCTTCCGGCAACGGAAGCAGGTGAGAGAACGACTGTTCCGAGCACCGTTTCGACGCGCTACATGACGCTGGCGATTACTCGTCGCATCG
ATAGCGTCGATGGCCATGGGCTCGGGTGCAGATTCCCGAGCTGAAGCAGGTAGCGCGTGAGCGTATGACGCCGCAACCACGTAGTCCTCGCGTAGGTCGA
GGGCAAATGTCTCTTCGAGTGTAGAGGGGTCCGATCTTGTAAAGCAGTAGCGCGTCATGCCTTCGCGCATACCGAACTAAACCTATGAGGCCATATCGAT
GGGCTTGGACACGATACACGACGCGAAGTGTCGTGGCTTCTGGACGTTGTCGCGCATAGTCATCGTGCCTTGCCGAAGGGCGAAGACGTCTGCCCGAATT
CAGGATTCATCTTGCGGCAGCTCGAACGCGAGCCGAATGTCACTCTGGAGAGTATCCACAGTGGCGAAGGCTTTGGGATCGACGACCAACTTGCCGAGAG
CCCATTTCTTGGCTTTCCCAGACAGCCGCGAGAGGAGGAAGTAGACCCTCGTGGAAGGCGCCTCGATCAACCTTGAGGCGATGGCGATGTCGATCTCTCG
AAACCAGCGATTCAGCGGGAGTCGGTCTTCTCCGGCATCGGCACCGGAGTAGGTGGACGTCTCTAGCTTCACGACGTCATTCGTGGAGATACGCGAGGGA
GTTGACACTCGCCGATTCGCATCGGCGAGCTCGCGTTTCATGAATTCTTGTGCCGCAATGCGCTGCTCATCGGGCGTCGCTGAGCGCAGCAGCGACGACT
TATCCGGACACCTCCGCGAGGCGGTGGAGAGATTCCCACTCGATCCGAGTGAGATGGGGGAAATCAGCGTGGTCGAGGGCTTGACTTATGTCGACTTTGG
TCATTGGAAGTACTACAAAGTGCTATCAGGTGTAACGGGCCAGGTATTTACTCCGTTACTTGCTTACACTATATCGTTGAGGAAGCTCGCAATAGGAAGA
CTGAGTCTTATGCTTAAGGAAAAATCAACTCTGAGTTTATTTTAGGACCAAGGCCACAGCCCTGGCCACTCAAATGCACGTCATAGTTCAATTGGCTAAT
AATGGGTCTGGCTCCCCATATATCAGCCAATGGCATGGCAGCATTTTCAGCACACGCTAGTCGTGTGCCGATGCACCTACTTATGTAAAGGAATCTACCT
ATTTCTGTAATGGAGGGGCCCATTACACAAGCAGTGAACCGCACTACACGATGTGTGCGAAGGCCGTCCCCGCGTTTCTGCTGTTTGATTCCATGGGTAT
ATTTCAGCGTCTTGCAGTAAACCACCCAGGAAGAAGGGATCAAATATCTCGGCGATACTTCGTTTAGATCCGTAGCCTTGTCGTCTTCATGCCCGGCTGA
ACCTTTTTGCGTGGCTTTGCCGAAATTGTCTCTTGCCTAAAATCTGTTTGTTTCGTATTTCAACTCAAGTTGTCGATCAAACGGGGAAGCGTTGATACGT
ATTTGCACTGAACAAATCGAATCGCTCGTGAAAAATGTCCCAAGATCTCCATCGAGCTGAAAATACAGTAAAGAAAGTGCCGTCACTGTCCGGAATTATT
GTATTCATGCCGAGGAGTCGATCCAGATATACATCCTCCGTTTCCGGTGTCAAACGCTGTACATCCTCCGGTTCAAAGTGTTGTTCTGCGCGCCTAGCCC
ATTCCGGTATATACCTCGGTAGCTCGTCCGATGTATATTTCTGTCGAAGGTTGACCTCCGATTTCTACTGTATCGGTGGTGGAGACTTCTGTACCCTACG
CAACGCCGTTGTACTCGACCTTGTTTACGGAGGCTCTGAGTCTTCGATCCACCACGCGAATTCTGTAGCGGTTCTGGAGTAGATCCAAGAGGACATATGC
CATGTAGATTCTTTCCAACTGGAGACTTGTCTTCACCGAATAACACCCGCATTATTGAACTACGCGTTTTTACTTTTTTTGCTGTCCTTTGAACGCCGTA
TTCGTCCTCAGACGGAAAATCATCATCTCCGCTATCGTCCAGGTCAGCCGCGTCATCACCAAACGCCATCGTAGCTTCCCTCAGGATCTCATGTAGCTAA
CGTGCATCCAATTTCTTGCGTTTCTTTGCCGTAGAGACGGCCTTCTTCTTACCAGAGCGTTTCAACAAGTCCGCCTCTTTCCCGACTTCAGGAGTCTTGT
CTACCGCAGAGCTCTATCTTCGCGCCTTCATTAGTGATGCGCCTCCAGCGTTTTTGTTTTGAAAAACAGCTTCTCCAGACTTTCATAAAGCAGTTGGCTG
TGCCTTTGCATAATCTTCGCGTACTCGTCTCGTCGCGCTTCTTTCGTTCTCTCGATGTTCTCCCTGAAACGCTTGAGCTGCTGTAAGCGACTTTGTACTG
ACGCTAGCGTCCTTGATCGCGAATTGCTCCGTACTCGTCCAGCGCTCACGCACGAGCGAATTGCTATCTTCGTCACTGGATTCAGAATCCAACACAGATA
TGAGGAAATGCTGTTTTCACGGTGCAAGCGGGGGGGGGGGCAAAGGCTGCTTACCATTCGCGCGCAGGCTTTGATCTGTACTCGGACGGCGGTACGATGG
TCAATCCTGAAAATTGACGGCTGTGGACGGCTATGGTAGCGCGACGCGATCTGAAGAATGACACGCGTCCATGGCAGACCACACAAAAAAGATCAGCAAA
ACAGAATTATAACAGAAAAAATTATAAAAATATCTTATCAATATTTCTGTGACGTGTGCTAGAGCTACATCATTTACAACCTGGTTCCGGTACATGCGGT
TGAGGATGGGCCAAAAAACTTGTCATTGGTATTTTTTAAAATTTCGGCAATTAAACCAAATCAAATACTTTTTAAGTTTTTTTATTGGCTCAAATGGTTC
TTTTGACGTGCACTTGCCGTTGCAACATGGTCGCGCCATGGTGCTTGCCGCGAGTAACTGAATGGGTGGTTATCGTGGTACTTGGACACGTGTGGAAGGC
AAAGTTTTCTAGCTACACGAATCCAAGTTTCTTAAGCTCGGGGAGGGAGGTCTCTGTTCGCAGTGCAGATCTGCAATCCAGCTCAAAAGAGTCAATCGAT
TATCAAAGGTAAGCACTCAACGATTTTCTCTCTTTCTGCGCAAGCGAGTCAGAGACTTCGGAAGAACCGCAGCTACTCAAGCTGTTTCATCCTACGAACA
TATGGCAGCAAGGGTGCGCCAAGCTCCCAGTGTTGGCAGATCTTCTGGTCAAAGTAAACTCGTCTCCTGCTTCTACTGCTGGTGTTAAACGTCAGCACAA
AGTTGGAAAGCGGATCCACTGTGTTTCCAGGAGCTGAATCGGCACTGGGATGGTAGAAGAGCAGGTCGCTTTTGCGCATAACGCTGTCGTCGCAAAGATG
TAGATATCGTCCGAAAGATAGTCTTTGAGCAACGAATAGTCTCCGAAATACTCGAAAAAGGAGAGCATTTGGAATATGTTATTCGAGATGAGGCGCCAAC
AGTCGAGGACACAGGAGTTGCCGACGATAACTTTCTGTTTACGGAGGCCGCGGAGTAGCAAATACTACTGTAGTACTGTATAAGCTACACGTAAGTAAAT
AGGGAACGTAGGATAATAGTAGTAGTAGTAGTAGAAGTAAGAAATAGTAGTAGAGCAGCTCTACCAAATTGCATGTGATACCTGTGTCGATTAATATTAA
AACCAAGACAGGCAAAAGCAAAAGAATAAACCCGTTTTTAATCCAGGGTTTTCTTTTAATTTAAAAACCAACCCATCCATAGTGTAACTGTTACAAGAGG
CTGCGTCAAGGACTTAATTTTTTATATGAATGGAAAAGCAAAGGTGCTCAAAAATAATCCATCGTCATCTTAGATAACGACTTCATACAAAATGTCCTAT
CTGTTAGTGATAAATAAATTAGGTTGTTCAGCTCTAATTATATTGATTAGCAAGCTGCAAGTTAGAGAAGTTGATCTATAGTAGAAACATCCCAAAAACG
GGAGTTTTCTCGCAGGAAAAAAATAATTTCCAGCGTAATGGACTGCAAGCCATTACGCTCTTGCCCAAGTGTTGTGCGAGCAACACTAAAAAACCGCTCC
ACCTTGTTCGAGTAGCCGGAATGCTGCTAACGAGGCTGCATCGGACTACTCTTGGATCAAGCCGGCGACGCTTTTTAAGCCGCTGTACAAAATGCTCATA
ATCGGTTTCTTCTTCATAATTGTATGGGTTGATTGTTAGGGTCCGCAAGAAGGAAAGGACGAAGAGCCCGCTTCTCTGCTGTGGTGAGGCGGGCTTCACA
TCCTTTAAGAACCCGGACACAGCCCGACTCAAAGTCTGGGCTGTCAACGATGTTTGCCCGAGGACCTATGTGTATCACTTTAAGCTAGCAAATATTATAA
AGCACTAGAAACAAAGCAAACCGTACCGACATAAGTAGCAAGCGCAGGCTGTACTTCAATAAGTCCGTCGAGCCGTGCACGCGCGTCCAGTAAGCTCACG
TTCTCTCCTTGTAAGGCTTTTGGCACTAACTCAAAGTCCTTGAGGTCTGCGTAGAGCTTCTTGAGTCGGCGATTGCACGCCGGAGACGGAAGCAAGTCCA
GGGGCTCTGCATCTTCTCGGTCAAAAACTCCAACAGGGAAAAACAGCGATGCACTATTGCGAAGGTGGATCCCAGCGGGTATCCTGACGAATGACTGGCC
GAAGTAGAGTCTTGAATCTAATAAAAACAAATTACCATATTAGTCGCGTATTAGTAATACAAAACGATACTAGTACTAAAGTAGAAATCAATAGTAAAAT
CAAAAGTACTTACCGAAGTTTCGTTGACTGCTTAAGCGTCCGCAGCTTTGACATCAGAGCTTGCACAGCAGCCAAATCTTCGTCGTGCTTTGCCAAGTGA
TGTGGAGCCGCCCAATTTACTAGCACATCCGACCAATGACACTTGCACTATGGTTGCGAGTCGCCTTTTCACAGAACAGTTGTCCCCGACCAGGTGCTTG
CAGCAGCTTAGATTTTTCCCACAATCTCTTTCGAGCGTTTCCTCTAGAAAAGCGCGATGGATGCGGGCTGACAAGTCCTCGTCCGGCTCGTTGATGACCG
GGGCTATGCTAAGGGGCTG